Quick Order

Text Size:AAA

Human Carboxypeptidase E/CPE Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CPE cDNA Clone Product Information
NCBI RefSeq:NM_001873.2
RefSeq ORF Size:1431bp
cDNA Description:Full length Clone DNA of Homo sapiens carboxypeptidase E.
Gene Synonym:CPE
Restriction Site:KpnI + XhoI (5.5kb + 1.43kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CPE Gene Plasmid Map
Human CPE Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Human carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Size / Price
    Catalog: HG10069-M-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human CPE Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.