Carboxypeptidase E cDNA ORF Clone, Human, untagged

Cat: HG10069-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Carboxypeptidase E Reagents
CRO Services

All Carboxypeptidase E Reagents
Carboxypeptidase E cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1431 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carboxypeptidase E.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 1.43kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Carboxypeptidase E cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase E cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
Carboxypeptidase E Background Information

Carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

Full Name
carboxypeptidase E
References
  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Carboxypeptidase E cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase E cDNA ORF Clone in Cloning Vector, Mouse MG51055-U
    Carboxypeptidase E cDNA ORF Clone, Mouse, untagged MG51055-UT
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51055-ACG
    Carboxypeptidase E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51055-ACGLN
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51055-ANG
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51055-ACR
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51055-ANR
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51055-CF
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51055-NF
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-His tag MG51055-CH
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-His tag MG51055-NH
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-HA tag MG51055-CY
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-HA tag MG51055-NY
    Carboxypeptidase E cDNA ORF Clone, Mouse, C-Myc tag MG51055-CM
    Carboxypeptidase E cDNA ORF Clone, Mouse, N-Myc tag MG51055-NM
    Carboxypeptidase E qPCR Primer Pairs, Mouse MP201013

    Carboxypeptidase E cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase E cDNA ORF Clone in Cloning Vector, Human HG10069-M
    Carboxypeptidase E cDNA ORF Clone, Human, untagged HG10069-UT
    Carboxypeptidase E cDNA ORF Clone, Human, C-GFPSpark® tag HG10069-ACG
    Carboxypeptidase E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10069-ACGLN
    Carboxypeptidase E cDNA ORF Clone, Human, C-OFPSpark® tag HG10069-ACR
    Carboxypeptidase E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10069-CF
    Carboxypeptidase E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10069-NF
    Carboxypeptidase E cDNA ORF Clone, Human, C-His tag HG10069-CH
    Carboxypeptidase E cDNA ORF Clone, Human, N-His tag HG10069-NH
    Carboxypeptidase E cDNA ORF Clone, Human, C-HA tag HG10069-CY
    Carboxypeptidase E cDNA ORF Clone, Human, N-HA tag HG10069-NY
    Carboxypeptidase E cDNA ORF Clone, Human, C-Myc tag HG10069-CM
    Carboxypeptidase E cDNA ORF Clone, Human, N-Myc tag HG10069-NM
    Carboxypeptidase E qPCR Primer Pairs, Human HP100155
    info info
    添加购物车成功! 添加购物车失败!