Quick Order

Human CNDP2 Gene ORF cDNA clone expression plasmid

  • Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human CNDP2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 105G/A and 570 T/C that do not cause any amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CNDP2 qPCR primers for gene expression analysis, HP100236 )
Promoter:
Application:
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CNDP2 Gene Plasmid Map
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2, is a cytoplasm protein which belongs to the peptidase M20A family. CNDP2 / CPGL is a cytosolic enzyme that can hydrolyze carnosine to yield l-histidine and beta-alanine. CNDP2 / CPGL hydrolyzes a variety of dipeptides including L-carnosine but has a strong preference for Cys-Gly. It may be play a role as tumor suppressor in hepatocellular carcinoma (HCC) cells. Isoform 1 of CNDP2 / CPGL is ubiquitously expressed with higher levels in kidney and liver (at protein level). Isoform 2 of CNDP2 / CPGL is expressed in fetal tissues, it is only expressed in adult liver and placental tissues. CNDP2 / CPGL is highly expressed in the histaminergic neurons in the tuberomammillary nucleus, implying that it may supply histidine to histaminergic neurons for histamine synthesis.

References
  • Bakker,SJ. et al., 2008, Diabetes  57 (12):e16; author reply e17. 
  • Wanic, K. et al., 2008, Diabetes  57 (9): 2547-51.
  • McDonough,CW. et al., 2009, Hum Genet 126 (2): 265-75.
  • Kaur,H. et al., 2009, J Biol Chem. 284 (21):14493-502.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"