Quick Order

Human CLUL1 Gene ORF cDNA clone expression plasmid

  • Human CLUL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human CLUL1 cDNA Clone Product Information
NCBI RefSeq:NM_014410.4
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Homo sapiens clusterin-like 1 (retinal).
Gene Synonym:RA337M
Restriction Site:KpnI + XhoI (5.5kb + 1.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
( We provide with CLUL1 qPCR primers for gene expression analysis, HP104839 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CLUL1 Gene Plasmid Map
Human CLUL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CLUL1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG12525-G-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.