Dectin-2 cDNA ORF Clone, Human, untagged

Cat: HG10250-M-N

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Dectin-2 Reagents
CRO Services

All Dectin-2 Reagents
Dectin-2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
630 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human C-type lectin domain family 6, member A DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Dectin-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Dectin-2 cDNA ORF Clone, Human, untagged Alternative Names
CLEC4N cDNA ORF Clone, Human;CLEC6A cDNA ORF Clone, Human;CLECSF10 cDNA ORF Clone, Human;DECTIN2 cDNA ORF Clone, Human
Dectin-2 Background Information

C-type lectin domain family 4 member N (CLEC4N), also known as Dectin-2, is a C-type lectin expressed by dendritic cells (DCs) and macrophages. Members of the C-type lectin domain (CTLD) superfamily are metazoan proteins functionally important in glycoprotein metabolism, mechanisms of multicellular integration and immunity. They share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp family was essentially formed early in vertebrate evolution and is completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates. Dectin-2 is important in host defense against C. albicans by inducing Th17 cell differentiation. Dectin-2 constitutes a major fungal pattern recognition receptor (PRR) that can couple to the Syk-CARD9 innate signaling pathway to activate DCs and regulate adaptive immune responses to fungal infection.

Full Name
C-type lectin domain family 6 member A
References
  • Robinson MJ, et al. (2009) Dectin-2 is a Syk-coupled pattern recognition receptor crucial for Th17 responses to fungal infection. J Exp Med. 206(9): 2037-51.
  • Saijo S, et al. (2010) Dectin-2 recognition of alpha-mannans and induction of Th17 cell differentiation is essential for host defense against Candida albicans. Immunity. 32(5): 681-91.
  • info info
    添加购物车成功! 添加购物车失败!