Quick Order

Ferret CD8/CD8 alpha/Leu-2 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Ferret CD8A cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Ferret CD8A Gene Plasmid Map
Ferret CD8a / CD8 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Human T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.