CD72 cDNA ORF Clone, Human, untagged

Cat: HG12507-G-N

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD72 Reagents
CRO Services

All CD72 Reagents
CD72 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD72 molecule DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD72 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD72 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
CD72 cDNA ORF Clone, Human, untagged Alternative Names
CD72b cDNA ORF Clone, Human;LYB2 cDNA ORF Clone, Human
CD72 Background Information
Full Name
CD72 molecule

CD72 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD72 cDNA ORF Clone in Cloning Vector, Mouse MG50732-G
CD72 cDNA ORF Clone in Cloning Vector, Mouse MG5A7600-U
CD72 cDNA ORF Clone, Mouse, untagged MG50732-UT
CD72 cDNA ORF Clone, Mouse, untagged MG5A7600-UT
CD72 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50732-ACGLN
CD72 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7600-ACGLN
CD72 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50732-ACG
CD72 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7600-ACG
CD72 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7600-ACR
CD72 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50732-ACR
CD72 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7600-CF
CD72 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50732-CF
CD72 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50732-NF
CD72 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7600-NF
CD72 cDNA ORF Clone, Mouse, C-His tag MG5A7600-CH
CD72 cDNA ORF Clone, Mouse, C-His tag MG50732-CH
CD72 cDNA ORF Clone, Mouse, N-His tag MG50732-NH
CD72 cDNA ORF Clone, Mouse, N-His tag MG5A7600-NH
CD72 cDNA ORF Clone, Mouse, C-HA tag MG5A7600-CY
CD72 cDNA ORF Clone, Mouse, C-HA tag MG50732-CY
CD72 cDNA ORF Clone, Mouse, N-HA tag MG50732-NY
CD72 cDNA ORF Clone, Mouse, N-HA tag MG5A7600-NY
CD72 cDNA ORF Clone, Mouse, C-Myc tag MG50732-CM
CD72 cDNA ORF Clone, Mouse, C-Myc tag MG5A7600-CM
CD72 cDNA ORF Clone, Mouse, N-Myc tag MG5A7600-NM
CD72 cDNA ORF Clone, Mouse, N-Myc tag MG50732-NM
CD72 qPCR Primer Pairs, Mouse MP200707

CD72 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD72 cDNA ORF Clone, Human, untagged HG12507-UT
CD72 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12507-ACGLN
CD72 qPCR Primer Pairs, Human HP104826
info info
添加购物车成功! 添加购物车失败!