Text Size:AAA

Cynomolgus monkey CD70 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD70cDNA Clone Product Information
Gene Bank Ref.ID:unsubmitted
cDNA Size:612
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD70 molecule DNA.
Gene Synonym:TNFSF7, CD70
Restriction Site:KpnI + XhoI
Sequence Description:Identical with EF396938.1 [ Macaca mulatta (Rhesus monkey) ]: 112 G/A resulting in the amino acid Val substitution by Ile. Please check the sequence information before order.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro-FLAG Physical Map
Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Human XEDAR / EDA2R Protein (Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Human TNF-alpha / TNFA ProteinCanine TNF-alpha / TNFA / TNFSF1A ProteinCynomolgus TNF-alpha / TNFA ProteinCanine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Canine CD40 / TNFRSF5 Protein (His Tag)Canine CD40 / TNFRSF5 ProteinHuman RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinHuman CD40 / TNFRSF5 Protein (ECD, Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinMouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinRat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinRat BAFFR / TNFRSF13C Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Cynomolgus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinRat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinHuman RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinHuman BLyS / TNFSF13B / BAFF Protein (Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinCynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human Fas Ligand / FASLG / CD95L Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Human Osteoprotegerin / TNFRSF11B Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinHuman TNFRSF11A Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Human TNFRSF11A Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human XEDAR / EDA2R Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinFerret TNF-alpha / TNFA ProteinHuman EDAR / DL Protein (His Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human EDAR / DL Protein (Fc Tag)

CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature dendritic cells. Binding of CD70 to its receptor, CD27, is important in priming, effector functions, differentiation and memory formation of T-cells as well as plasma and memory B-cell generation. Tight control of CD70 expression is required to prevent lethal immunodeficiency. By selective transcription, CD70 is largely confined to activated lymphocytes and dendritic cells (DC). As a type II transmembrane receptor, CD70 is normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types. The restricted expression pattern of CD70 in normal tissues and its widespread expression in various malignancies makes it an attractive target for antibody-based therapeutics. Investigations to exploit CD70 as a cancer target have lead to the identification of potential antibody-based clinical candidates.

  • Adam PJ, et al. (2006) CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding. Br J Cancer. 95(3): 298-306.
  • Keller AM, et al. (2007) Costimulatory ligand CD70 is delivered to the immunological synapse by shared intracellular trafficking with MHC class II molecules. Proc Natl Acad Sci U S A. 104(14): 5989-94.
  • Grewal IS. (2008) CD70 as a therapeutic target in human malignancies. Expert Opin Ther Targets. 12(3): 341-51.
  • Boursalian TE, et al. (2009) Targeting CD70 for human therapeutic use. Adv Exp Med Biol. 647: 108-19.