Quick Order

Human CD55/DAF transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CD55/DAF cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Human CD55/DAF Gene Plasmid Map
Human CD55 / DAF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 30 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 70-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.

  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.
  • Contact Us
    • Human CD55 / DAF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.