Our new search engine has been lanuched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Mouse CD40L/CD40LG cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Mouse CD40L/CD40LG Gene Plasmid Map
Mouse CD40L / TNFSF5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.