CD40 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10774-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD40 Reagents
CRO Services

All CD40 Reagents
CD40 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD40 molecule, TNF receptor superfamily member 5 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.86kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD40 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD40 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CD40/TNFRSF5 Gene Plasmid Map 7343
CD40 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
Bp50 cDNA ORF Clone, Human;CDW40 cDNA ORF Clone, Human;p50 cDNA ORF Clone, Human;TNFRSF5 cDNA ORF Clone, Human
CD40 Background Information

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD40 molecule, TNF receptor superfamily member 5
References
  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.
  • CD40 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD40 cDNA ORF Clone in Cloning Vector, Rhesus CG90097-G
    CD40 cDNA ORF Clone, Rhesus, untagged CG90097-UT
    CD40 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90097-ACG
    CD40 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90097-ACGLN
    CD40 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90097-ACR
    CD40 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90097-CF
    CD40 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90097-NF
    CD40 cDNA ORF Clone, Rhesus, C-His tag CG90097-CH
    CD40 cDNA ORF Clone, Rhesus, N-His tag CG90097-NH
    CD40 cDNA ORF Clone, Rhesus, C-HA tag CG90097-CY
    CD40 cDNA ORF Clone, Rhesus, N-HA tag CG90097-NY
    CD40 cDNA ORF Clone, Rhesus, C-Myc tag CG90097-CM
    CD40 cDNA ORF Clone, Rhesus, N-Myc tag CG90097-NM

    CD40 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD40 cDNA ORF Clone in Cloning Vector, Rat RG80151-G
    CD40 cDNA ORF Clone, Rat, untagged RG80151-UT
    CD40 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80151-ACGLN
    CD40 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80151-ACG
    CD40 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80151-ACR
    CD40 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80151-CF
    CD40 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80151-NF
    CD40 cDNA ORF Clone, Rat, C-His tag RG80151-CH
    CD40 cDNA ORF Clone, Rat, N-His tag RG80151-NH
    CD40 cDNA ORF Clone, Rat, C-HA tag RG80151-CY
    CD40 cDNA ORF Clone, Rat, N-HA tag RG80151-NY
    CD40 cDNA ORF Clone, Rat, C-Myc tag RG80151-CM
    CD40 cDNA ORF Clone, Rat, N-Myc tag RG80151-NM
    CD40 qPCR Primer Pairs, Rat RP300170

    CD40 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD40 cDNA ORF Clone in Cloning Vector, Human HG10774-M
    CD40 cDNA ORF Clone, Human, untagged HG10774-UT
    CD40 cDNA ORF Clone, Human, untagged HG16492-G-N
    CD40 cDNA ORF Clone, Human, C-GFPSpark® tag HG10774-ACG
    CD40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16492-ACGLN
    CD40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10774-ACGLN
    CD40 cDNA ORF Clone, Human, C-OFPSpark® tag HG10774-ACR
    CD40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10774-CF
    CD40 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10774-NF
    CD40 cDNA ORF Clone, Human, C-His tag HG10774-CH
    CD40 cDNA ORF Clone, Human, N-His tag HG10774-NH
    CD40 cDNA ORF Clone, Human, C-HA tag HG10774-CY
    CD40 cDNA ORF Clone, Human, N-HA tag HG10774-NY
    CD40 cDNA ORF Clone, Human, C-Myc tag HG10774-CM
    CD40 cDNA ORF Clone, Human, N-Myc tag HG10774-NM
    CD40 qPCR Primer Pairs, Human HP100097

    CD40 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD40 qPCR Primer Pairs, Mouse MP200347
    info info
    添加购物车成功! 添加购物车失败!