Quick Order

Human CD34 transcript variant 1 Gene ORF cDNA clone expression plasmid

  • Human CD34 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human CD34 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
( We provide with CD34 qPCR primers for gene expression analysis, HP100178 )
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:
Human CD34 Gene Plasmid Map
Human CD34 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.