Quick Order

Rat CD32a/FCGR2A/Fc gamma RIIA Gene ORF cDNA clone expression plasmid, C-His tag

  • Rat FCGR2A / CD32a Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
DatasheetReviewsRelated ProductsProtocols
Rat CD32a cDNA Clone Product Information
NCBI RefSeq:NM_053843.2
RefSeq ORF Size:804bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Fc fragment of IgG, low affinity IIa, receptor (CD32) with His tag.
Gene Synonym:Fcgr3, Fcgr3a, Fcgr2a
Species:Rat
Vector:pCMV/hygro-His
Plasmid:pCMV-ratFCGR2A-10his
Restriction Site:KpnI + XhoI (5.5kb + 0.83kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FCGR2A qPCR primers for gene expression analysis, RP300014 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rat CD32a Gene Plasmid Map
Rat FCGR2A / CD32a Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: RG80015-M-H
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"