Quick Order

Human CD153/CD30L/TNFSF8 Gene ORF cDNA clone expression plasmid

  • Human CD30L / TNFSF8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human CD30L/TNFSF8 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:( We provide with TNFSF8 qPCR primers for gene expression analysis, HP100133 )
Human CD30L/TNFSF8 Gene Plasmid Map
Human CD30L / TNFSF8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD30/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD30L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD30L is capable of transducing signals through CD30 on different CD30+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD30-CD30 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD30 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.

  • Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.
  • Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.