Quick Order

Text Size:AAA

Human CD153/CD30L/TNFSF8 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CD30L/TNFSF8 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Human CD30L/TNFSF8 Gene Plasmid Map
Human CD30L / TNFSF8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD30/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD30L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD30L is capable of transducing signals through CD30 on different CD30+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD30-CD30 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD30 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.

  • Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.
  • Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.
  • Contact Us
    • Human CD30L / TNFSF8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.