CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-His tag

Cat: FG60005-G-H
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD3 epsilon / CD3e Reagents
CRO Services

All CD3 epsilon / CD3e Reagents
CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
561 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Ferret CD3 epsilon antigen with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
KpnI + XhoI (5.5kb + 0.59kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CD3 epsilon / CD3e cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-His tag Validated Images
Human Leptin Gene Plasmid Map 7138
CD3 epsilon / CD3e Background Information

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD3e molecule, epsilon (CD3-TCR complex)
References
  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • CD3 epsilon / CD3e cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Ferret FG60005-G
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, untagged FG60005-UT
    CD3 epsilon / CD3e Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60005-ACGLN
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60005-ACG
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60005-ACR
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60005-CF
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60005-NF
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-His tag FG60005-CH
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, N-His tag FG60005-NH
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-HA tag FG60005-CY
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, N-HA tag FG60005-NY
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, C-Myc tag FG60005-CM
    CD3 epsilon / CD3e cDNA ORF Clone, Ferret, N-Myc tag FG60005-NM

    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Rhesus CG90047-G
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, untagged CG90047-UT
    CD3 epsilon / CD3e Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90047-ACGLN
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90047-ACG
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90047-ACR
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90047-CF
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90047-NF
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, C-His tag CG90047-CH
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, N-His tag CG90047-NH
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, C-HA tag CG90047-CY
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, N-HA tag CG90047-NY
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, C-Myc tag CG90047-CM
    CD3 epsilon / CD3e cDNA ORF Clone, Rhesus, N-Myc tag CG90047-NM

    CD3 epsilon / CD3e cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Canine DG70106-G

    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Rabbit TG65002-G
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, untagged TG65002-UT
    CD3 epsilon / CD3e Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65002-ACGLN
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65002-ACG
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65002-ACR
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65002-CF
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65002-NF
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, C-His tag TG65002-CH
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, N-His tag TG65002-NH
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, C-HA tag TG65002-CY
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, N-HA tag TG65002-NY
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, C-Myc tag TG65002-CM
    CD3 epsilon / CD3e cDNA ORF Clone, Rabbit, N-Myc tag TG65002-NM

    CD3 epsilon / CD3e cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Rat RG8A6899-U
    CD3 epsilon / CD3e Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6899-ACGLN

    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Mouse MG50410-M
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, untagged MG50410-UT
    CD3 epsilon / CD3e Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50410-ACGLN
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50410-ACG
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50410-ACR
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50410-CF
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50410-NF
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, C-His tag MG50410-CH
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, N-His tag MG50410-NH
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, C-HA tag MG50410-CY
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, N-HA tag MG50410-NY
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, C-Myc tag MG50410-CM
    CD3 epsilon / CD3e cDNA ORF Clone, Mouse, N-Myc tag MG50410-NM
    CD3 epsilon / CD3e qPCR Primer Pairs, Mouse MP200424

    CD3 epsilon / CD3e cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD3 epsilon / CD3e cDNA ORF Clone in Cloning Vector, Human HG10977-M
    CD3 epsilon / CD3e cDNA ORF Clone, Human, untagged HG10977-UT
    CD3 epsilon / CD3e Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10977-ACGLN
    CD3 epsilon / CD3e cDNA ORF Clone, Human, C-GFPSpark® tag HG10977-ACG
    CD3 epsilon / CD3e cDNA ORF Clone, Human, C-OFPSpark® tag HG10977-ACR
    CD3 epsilon / CD3e cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10977-CF
    CD3 epsilon / CD3e cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10977-NF
    CD3 epsilon / CD3e cDNA ORF Clone, Human, C-His tag HG10977-CH
    CD3 epsilon / CD3e cDNA ORF Clone, Human, N-His tag HG10977-NH
    CD3 epsilon / CD3e cDNA ORF Clone, Human, C-HA tag HG10977-CY
    CD3 epsilon / CD3e cDNA ORF Clone, Human, N-HA tag HG10977-NY
    CD3 epsilon / CD3e cDNA ORF Clone, Human, C-Myc tag HG10977-CM
    CD3 epsilon / CD3e cDNA ORF Clone, Human, N-Myc tag HG10977-NM
    CD3 epsilon / CD3e qPCR Primer Pairs, Human HP100942
    info info
    添加购物车成功! 添加购物车失败!