After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetReviewsRelated ProductsProtocols
Human CD282/TLR2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human CD282/TLR2 Gene Plasmid Map
Human CD282 / TLR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

TLR2, also known as CD282, is a member of the Toll-like receptor (TLR) family. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They play a fundamental role in pathogen recognition and activation of innate immunity. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. TLR2 contains 14 LRR (leucine-rich) repeats and 1 TIR domain. TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. CD282 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It also cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. CD282 acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It may also promote apoptosis in response to lipoproteins.

  • Do KN, et al. (2012) TLR2 controls intestinal carcinogen detoxication by CYP1A1. PLoS ONE. 7 (3): e32309.
  • Dziarski R, et al. (2001) Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes. J Endotoxin Res. 6 (5): 401-5.
  • Lorenz E, (2007) TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 12 (32): 4185-93.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.