TLR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10061-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TLR2 Reagents
CRO Services

All TLR2 Reagents
TLR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2355 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human toll-like receptor 2 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 2.39kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TLR2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human TLR2 (CD282) Gene Expression validated Image 2384
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
TLR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD282 cDNA ORF Clone, Human;TIL4 cDNA ORF Clone, Human
TLR2 Background Information

TLR2, also known as CD282, is a member of the Toll-like receptor (TLR) family. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They play a fundamental role in pathogen recognition and activation of innate immunity. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. TLR2 contains 14 LRR (leucine-rich) repeats and 1 TIR domain. TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. CD282 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It also cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. CD282 acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It may also promote apoptosis in response to lipoproteins.

Full Name
toll-like receptor 2
References
  • Do KN, et al. (2012) TLR2 controls intestinal carcinogen detoxication by CYP1A1. PLoS ONE. 7 (3): e32309.
  • Dziarski R, et al. (2001) Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes. J Endotoxin Res. 6 (5): 401-5.
  • Lorenz E, (2007) TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 12 (32): 4185-93.
  • TLR2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TLR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90254-G
    TLR2 cDNA ORF Clone, Rhesus, untagged CG90254-UT
    TLR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90254-ACGLN
    TLR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90254-ACG
    TLR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90254-ACR
    TLR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90254-CF
    TLR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90254-NF
    TLR2 cDNA ORF Clone, Rhesus, C-His tag CG90254-CH
    TLR2 cDNA ORF Clone, Rhesus, N-His tag CG90254-NH
    TLR2 cDNA ORF Clone, Rhesus, C-HA tag CG90254-CY
    TLR2 cDNA ORF Clone, Rhesus, N-HA tag CG90254-NY
    TLR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90254-CM
    TLR2 cDNA ORF Clone, Rhesus, N-Myc tag CG90254-NM

    TLR2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TLR2 cDNA ORF Clone in Cloning Vector, Rat RG80400-G
    TLR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80400-ACGLN
    TLR2 cDNA ORF Clone, Rat, C-His tag RG80400-CH

    TLR2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TLR2 cDNA ORF Clone in Cloning Vector, Mouse MG50502-M
    TLR2 cDNA ORF Clone, Mouse, untagged MG50502-UT
    TLR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50502-ACG
    TLR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50502-ACGLN
    TLR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50502-ACR
    TLR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50502-CF
    TLR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50502-NF
    TLR2 cDNA ORF Clone, Mouse, C-His tag MG50502-CH
    TLR2 cDNA ORF Clone, Mouse, N-His tag MG50502-NH
    TLR2 cDNA ORF Clone, Mouse, C-HA tag MG50502-CY
    TLR2 cDNA ORF Clone, Mouse, N-HA tag MG50502-NY
    TLR2 cDNA ORF Clone, Mouse, C-Myc tag MG50502-CM
    TLR2 cDNA ORF Clone, Mouse, N-Myc tag MG50502-NM
    TLR2 qPCR Primer Pairs, Mouse MP200496

    TLR2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TLR2 cDNA ORF Clone in Cloning Vector, Human HG10061-M
    TLR2 cDNA ORF Clone, Human, untagged HG10061-UT
    TLR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10061-ACGLN
    TLR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10061-ACG
    TLR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10061-ACR
    TLR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10061-CF
    TLR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10061-NF
    TLR2 cDNA ORF Clone, Human, C-His tag HG10061-CH
    TLR2 cDNA ORF Clone, Human, N-His tag HG10061-NH
    TLR2 cDNA ORF Clone, Human, C-HA tag HG10061-CY
    TLR2 cDNA ORF Clone, Human, N-HA tag HG10061-NY
    TLR2 cDNA ORF Clone, Human, C-Myc tag HG10061-CM
    TLR2 cDNA ORF Clone, Human, N-Myc tag HG10061-NM
    TLR2 qPCR Primer Pairs, Human HP100149
    info info
    添加购物车成功! 添加购物车失败!