Quick Order

Human CD27/TNFRSF7 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Human CD27 / TNFRSF7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
DatasheetReviewsRelated ProductsProtocols
Human CD27/TNFRSF7 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
( We provide with CD27 qPCR primers for gene expression analysis, HP100132 )
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human CD27/TNFRSF7 Gene Plasmid Map
Human CD27 / TNFRSF7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD70 on lymphocytes and dendritic cells. The CD27-CD70 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.
  • Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.
  • Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.