After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human IL2RA/IL-2RA/CD25 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CD25/IL2Ra cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 516 C/T point mutation not causing the amino acid variation.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human CD25/IL2Ra Gene Plasmid Map
Human CD25 / IL2Rα Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

CD25 (alpha-chain of IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic domain. IL2RA is expressed on activated T cells and regulatory T cells, and is capable of binding IL2 with low affinity by itself. However, a ligand-induced high affinity heterotrimeric receptor complex is produced when IL2RA is associated non-covelently with the IL2 receptor beta and gamma chain, and subsequently initiates the intacellular signal pathways such as MAPK or JAK/STAT. On dendritic cells (DC), CD25 has been previously regarded as an activation marker, while both murine and human DC can express CD25, they do not express the beta-chain of the IL-2 receptor, which is indispensable for the execution of IL-2 signaling. The IL2RA (CD25) gene is a substantial component of the high-affinity receptor molecule highly expressed by activated T lymphocytes. Recently, a strong evidence was obtained for the involvement of IL-2RA in conferring susceptibility to type 1 diabetes (T1D). Cancer growth and development is associated with the stimulation of the innate immune system, including enhanced interleukin 2 receptor (IL-2R) expression in immune cells and its shedding into the circulation in a soluble form of sIL-2Ralpha. In most haematological malignancies, including different types of leukaemias and lymphomas, sIL-2Ralpha has been found to be released directly from the surface of neoplastic cells thus reflecting the tumour bulk, turnover and activity. Several studies have proved that not only lymphoid cancer cells, but also some non-lymphoid cancer cells, express IL-2R on their surface. They include malignant melanoma and carcinomas of the kidney, head and neck, oesophagus and lung. Thus, sIL-2Ralpha is elevated in most proliferative disturbances of the hematopoietic system and in many solid tumors.

  • Driesen J, et al. (2008) CD25 as an immune regulatory molecule expressed on myeloid dendritic cells. Immunobiology. 213(9-10): 849-58.
  • Olejniczak K, et al. (2008) Biological properties of interleukin 2 and its role in pathogenesis of selected diseases--a review. Med Sci Monit. 14(10): RA179-89.
  • Chistiakov DA, et al. (2008) The crucial role of IL-2/IL-2RA-mediated immune regulation in the pathogenesis of type 1 diabetes, an evidence coming from genetic and animal model studies. Immunol Lett. 118(1): 1-5.
  • Bien E, et al. (2008) Serum soluble interleukin 2 receptor alpha in human cancer of adults and children: a review. Biomarkers. 13(1): 1-26.
  • Contact Us
    • Human CD25 / IL2Rα Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.