Quick Order

Human CD166/ALCAM Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CD166/ALCAM cDNA Clone Product Information
NCBI RefSeq:NM_001627.2
RefSeq ORF Size:1752bp
cDNA Description:Full length Clone DNA of Homo sapiens activated leukocyte cell adhesion molecule with His tag.
Gene Synonym:ALCAM, MEMD, CD166, FLJ38514
Restriction Site:HindIII + XhoI (5.5kb + 1.78kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD166/ALCAM Gene Plasmid Map
Human CD166 / ALCAM Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Activated leukocyte cell adhesion molecule (ALCAM)/Cluster of differentiation (CD166) is a type I transmembrane cell adhesion molecule belonging to the Ig superfamily and a ligand for CD6 that is expressed on T lymphocytes. The extracellular domain of ALCAM contains five Ig-like domains (three Ig-like C2-type domains and two Ig-like V-type domains), of which the amino-terminal V1 domain is essential for ligand binding and ALCAM-mediated cell aggregation. ALCAM mediates both heterophilic (ALCAM-CD6) and homophilic (ALCAM-ALCAM) cell-cell interactions. ALCAM/CD6 interaction plays a role in T cell development and T cell regulation, as well as in the binding of T- and B-cells to activated leukocytes. Recently, homophilic (ALCAM-ALCAM) adhesion was shown to play important roles in tight cell-to-cell interaction and regulation of stem cell differentiation. While expressed in a wide variety of tissues, ALCAM is usually restricted to subsets of cells involved in dynamic growth and/or migration, including neural development, branching organ development, hematopoiesis, immune response and tumor progression. And CD166 is regarded as a potential novel breast cancer indicator and therapeutic target.

  • Swart GW. (2002) Activated leukocyte cell adhesion molecule (CD166/ALCAM): developmental and mechanistic aspects of cell clustering and cell migration. Eur J Cell Biol. 81(6): 313-21.
  • Fujiwara H, et al. (2003) Human blastocysts and endometrial epithelial cells express activated leukocyte cell adhesion molecule (ALCAM/CD166). J Clin Endocrinol Metab. 88(7): 3437-43.
  • Jezierska A, et al. (2006) ALCAM/CD166 protects breast cancer cells against apoptosis and autophagy. Med Sci Monit. 12(8): BR263-73.
  • Kahlert C, et al. (2009) Increased expression of ALCAM/CD166 in pancreatic cancer is an independent prognostic marker for poor survival and early tumour relapse. Br J Cancer. 101(3): 457-64.
  • Contact Us
    • Human CD166 / ALCAM Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.