MDC cDNA ORF Clone, Human, untagged

Cat: HG10163-M-N

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MDC Reagents
CRO Services

All MDC Reagents
MDC cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 22 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MDC cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MDC cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
MDC cDNA ORF Clone, Human, untagged Alternative Names
A-152E5.1 cDNA ORF Clone, Human;ABCD-1 cDNA ORF Clone, Human;DC/B-CK cDNA ORF Clone, Human;MDC cDNA ORF Clone, Human;SCYA22 cDNA ORF Clone, Human;STCP-1 cDNA ORF Clone, Human
MDC Background Information

Chemokine (C-C motif) ligand 22(ABCD-1 / CCL22)is a kind of CC chemokine which is a family of secreted proteins involved in immunoregulatory and inflammatory processes. The cytokine displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. This ABCD-1 / CCL22 chemokine binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated / effector T lymphocytes to inflammatory sites and other aspects of activated T-lymphocyte physiology. ABCD-1 / CCL22 is highly expressed in macrophage and in monocyte-derived dendritic cells, and thymus, and in Langerhans' cell histiocytosis and atopic dermatitis but not in dermatopathic lymphadenopathy. This chemokine is also found in lymph node, appendix, activated monocytes, resting and activated macrophages. This protein is lower expressed in lung and spleen and very weekly expressed in small intestine.

Full Name
chemokine (C-C motif) ligand 22
References
  • Vulcano M, et al. (2001) Dendritic cells as a major source of macrophage-derived chemokine/CCL22 in vitro and in vivo. Eur J Immunol. 31(3): 812-22.
  • Kwon DJ, et al. (2011) Casuarinin suppresses TARC/CCL17 and MDC/CCL22 production via blockade of NF-?B and STAT1 activation in HaCaT cells. Biochem Biophys Res Commun. 417(4):1254-9.
  • Hirota T, et al. (2011) Variants of C-C motif chemokine 22 (CCL22) are associated with susceptibility to atopic dermatitis: case-control studies. PLoS One. 6(11):e26987.
  • MDC cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MDC cDNA ORF Clone in Cloning Vector, Mouse MG51135-G
    MDC cDNA ORF Clone, Mouse, untagged MG51135-UT
    MDC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51135-ACGLN
    MDC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51135-ACG
    MDC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51135-ACR
    MDC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51135-CF
    MDC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51135-NF
    MDC cDNA ORF Clone, Mouse, C-His tag MG51135-CH
    MDC cDNA ORF Clone, Mouse, N-His tag MG51135-NH
    MDC cDNA ORF Clone, Mouse, C-HA tag MG51135-CY
    MDC cDNA ORF Clone, Mouse, N-HA tag MG51135-NY
    MDC cDNA ORF Clone, Mouse, C-Myc tag MG51135-CM
    MDC cDNA ORF Clone, Mouse, N-Myc tag MG51135-NM

    MDC cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MDC cDNA ORF Clone in Cloning Vector, Human HG10163-G
    MDC cDNA ORF Clone, Human, untagged HG10163-UT
    MDC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10163-ACGLN
    MDC cDNA ORF Clone, Human, C-GFPSpark® tag HG10163-ACG
    MDC cDNA ORF Clone, Human, C-OFPSpark® tag HG10163-ACR
    MDC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10163-CF
    MDC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10163-NF
    MDC cDNA ORF Clone, Human, C-His tag HG10163-CH
    MDC cDNA ORF Clone, Human, N-His tag HG10163-NH
    MDC cDNA ORF Clone, Human, C-HA tag HG10163-CY
    MDC cDNA ORF Clone, Human, N-HA tag HG10163-NY
    MDC cDNA ORF Clone, Human, C-Myc tag HG10163-CM
    MDC cDNA ORF Clone, Human, N-Myc tag HG10163-NM
    MDC qPCR Primer Pairs, Human HP100233
    info info
    添加购物车成功! 添加购物车失败!