Quick Order

Mouse CCL20/MIP-3 alpha/MIP3A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CCL20 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Mouse
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Storage:
Mouse CCL20 Gene Plasmid Map
Mouse CCL20 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is a small cytokine belonging to the CC chemokine family that attracts immature dendritic cells and memory T lymphocytes, both expressing CCR6. Depending on the cell type, this chemokine was found to be inducible by cytokines (IL-1beta) and by bacterial, viral, or plant products (including LPS, dsRNA, and PMA). MIP3A / CCL20 is Expressed predominantly in the liver, lymph nodes, appendix, peripheral blood lymphocytes, and fetal lung. Low levels of MIP3A / CCL20 has been seen in thymus, prostate, testis, small intestine and colon. As a chemotactic factor, MIP3A / CCL20 attracts lymphocytes and, slightly, neutrophils, but not monocytes. This chemokine may Inhibit proliferation of myeloid progenitors in colony formation assays and it may be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. Its C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Chemokine CCL20 was shown to play a role in colorectal cancer (CRC) pathogenesis.

References
  • Vicinus B, et al. (2012) miR-21 functionally interacts with the 3'UTR of chemokine CCL20 and down-regulates CCL20 expression in miR-21 transfected colorectal cancer cells. Cancer Lett. 316(1): 105-12.
  • Ding X, et al. (2012) High Expression of CCL20 Is Associated with Poor Prognosis in Patients with Hepatocellular Carcinoma after Curative Resection. J Gastrointest Surg. 16(4): 828-36.
  • Ivison SM, et al. (2010) Oxidative stress enhances IL-8 and inhibits CCL20 production from intestinal epithelial cells in response to bacterial flagellin. Am J Physiol Gastrointest Liver Physiol. 299(3): 733-41.
  • Contact Us
    Images
    • Mouse CCL20 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"