Quick Order

Human MCP-1/CCL2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CCL2/MCP-1 cDNA Clone Product Information
NCBI RefSeq:NM_002982.3
RefSeq ORF Size:299
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 2 DNA.
Gene Synonym:HC11, MCAF, MCP1, MCP-1, SCYA2, GDCF-2, SMC-CF, HSMCR30, MGC9434
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Same as Gene Bank Ref. ID sequence with the nucleotide 10T deletion mutation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Human CCL2/MCP-1 Gene Plasmid Map
Human CCL2 / MCP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10134-M-N
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability5 business days
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human CCL2 / MCP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"