Quick Order

Text Size:AAA

Human MCP-1/CCL2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CCL2/MCP-1 cDNA Clone Product Information
NCBI RefSeq:NM_002982.3
RefSeq ORF Size:299
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 2 DNA.
Gene Synonym:HC11, MCAF, MCP1, MCP-1, SCYA2, GDCF-2, SMC-CF, HSMCR30, MGC9434
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Same as Gene Bank Ref. ID sequence with the nucleotide 10T deletion mutation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Human CCL2/MCP-1 Gene Plasmid Map
Human CCL2 / MCP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10134-M-N
List Price: 
Price:      (You Save: )
Availability5 business days
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human CCL2 / MCP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.