TARC cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10233-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TARC Reagents

CRO Services


All TARC Reagents

TARC cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
285 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 17 with Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XbaI (5.4kb + 0.34kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TARC cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TARC cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

A-152E5.3 cDNA ORF Clone, Human;ABCD-2 cDNA ORF Clone, Human;SCYA17 cDNA ORF Clone, Human;TARC cDNA ORF Clone, Human

TARC Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 17 (CCL17), also known as thymus and activation regulated chemokine(TARC), is a small cytokine belonging to the C-C chemokine family. CCL17 is expressed maily in thymus and transiently in phytohemagglutinin-stimulated peripheral blood mononuclear cells. CCL17 can induce chemotaxis in T cells by binding with the chemokine receptor CCR4.

Full Name
chemokine (C-C motif) ligand 17
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Morita A, et al. (2002). Evaluation of human thymus and activation-regulated chemokine concentrations in blood using a new sandwich ELISA based on monoclonal antibodies. Clin Chim Acta. 322 (1-2): 67-75.
  • TARC cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TARC cDNA ORF Clone in Cloning Vector, Rhesus CG90077-G
    TARC cDNA ORF Clone, Rhesus, untagged CG90077-UT
    TARC cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90077-ACG
    TARC Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90077-ACGLN
    TARC cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90077-ACR
    TARC cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90077-CF
    TARC cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90077-NF
    TARC cDNA ORF Clone, Rhesus, C-His tag CG90077-CH
    TARC cDNA ORF Clone, Rhesus, N-His tag CG90077-NH
    TARC cDNA ORF Clone, Rhesus, C-HA tag CG90077-CY
    TARC cDNA ORF Clone, Rhesus, N-HA tag CG90077-NY
    TARC cDNA ORF Clone, Rhesus, C-Myc tag CG90077-CM
    TARC cDNA ORF Clone, Rhesus, N-Myc tag CG90077-NM

    TARC cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TARC cDNA ORF Clone in Cloning Vector, Mouse MG50046-M
    TARC cDNA ORF Clone, Mouse, untagged MG50046-UT
    TARC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50046-ACGLN
    TARC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50046-ACG
    TARC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50046-ACR
    TARC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50046-CF
    TARC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50046-NF
    TARC cDNA ORF Clone, Mouse, C-His tag MG50046-CH
    TARC cDNA ORF Clone, Mouse, N-His tag MG50046-NH
    TARC cDNA ORF Clone, Mouse, C-HA tag MG50046-CY
    TARC cDNA ORF Clone, Mouse, N-HA tag MG50046-NY
    TARC cDNA ORF Clone, Mouse, C-Myc tag MG50046-CM
    TARC cDNA ORF Clone, Mouse, N-Myc tag MG50046-NM
    TARC qPCR Primer Pairs, Mouse MP200046

    TARC cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TARC cDNA ORF Clone in Cloning Vector, Human HG10233-M
    TARC cDNA ORF Clone, Human, untagged HG10233-UT
    TARC cDNA ORF Clone, Human, C-GFPSpark® tag HG10233-ACG
    TARC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10233-ACGLN
    TARC cDNA ORF Clone, Human, C-OFPSpark® tag HG10233-ACR
    TARC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10233-CF
    TARC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10233-NF
    TARC cDNA ORF Clone, Human, C-His tag HG10233-CH
    TARC cDNA ORF Clone, Human, N-His tag HG10233-NH
    TARC cDNA ORF Clone, Human, C-HA tag HG10233-CY
    TARC cDNA ORF Clone, Human, N-HA tag HG10233-NY
    TARC cDNA ORF Clone, Human, C-Myc tag HG10233-CM
    TARC cDNA ORF Clone, Human, N-Myc tag HG10233-NM
    TARC qPCR Primer Pairs, Human HP100091
    info info
    添加购物车成功! 添加购物车失败!