MCP-4 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

MCP-4 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 13 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 0.35kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

MCP-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCP-4 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: Alternative Names

CCL13 cDNA ORF Clone, Human; CKb10 cDNA ORF Clone, Human; MCP-4 cDNA ORF Clone, Human; MCP4 cDNA ORF Clone, Human; NCC-1 cDNA ORF Clone, Human; NCC1 cDNA ORF Clone, Human; SCYA13 cDNA ORF Clone, Human; SCYL1 cDNA ORF Clone, Human

MCP-4 Background Information

Monocyte Chemoattractant Proteins 4 (MCP-4/CCL13) is a member of a distinct, structurally-related subclass of CC chemokines mainly involved in recruitment of eosinphils to inflammatory sites. CCL13/MCP-4, is a CC family chemokine that is chemoattractant for eosinophils, basophils, monocytes, macrophages, immature dendritic cells, and T cells, and its capable of inducing crucial immuno-modulatory responses through its effects on epithelial, muscular and endothelial cells. Similar to other CC chemokines, CCL13 binds to several chemokine receptors (CCR1, CCR2 and CCR3), allowing it to elicit different effects on its target cells. A number of studies have shown that CCL13 is involved in many chronic inflammatory diseases, in which it functions as a pivotal molecule involved in the selective recruitment of cell lineages to the inflamed tissues and their subsequent activation. MCP-4/CCL13 is secreted from chondrocytes and activates the proliferation of rheumatoid synovial cells, thereby leading to joint destruction in RA. The interferon-gamma in combination with interleukin-1beta/tumor necrosis factor-alpha activates the production of MCP-4/CCL13 from chondrocytes in RA joints, and that secreted MCP-4/CCL13 enhances fibroblast-like synoviocyte proliferation by activating the extracellular signal-regulated kinase mitogen-activated protein kinase cascade. CCL13 may have some role in the pathogenesis of systemic sclerosis (SSc).
Full Name
chemokine (C-C motif) ligand 13
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait