Quick Order

DatasheetReviewsRelated ProductsProtocols
Human CCL1/TCA3 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human CCL1/TCA3 Gene Plasmid Map
Human CCL1 / TCA3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

CCL1 or chemokine (C-C motif) ligand 1, also known as I-309 or TCA-3, is a member of the chemokine (C-C motif) ligand family. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. I-309/CCL1/TCA-3 interacts with the G protein-linked transmembrane chemokine receptors CCR8, and induces biochemical events that may result in the control of chemotaxis, proliferation, apoptosis and adhesion. It has been demonstrated that I-309/CCL1/TCA-3 displays chemotactic activity for monocytes and other cell types such as NK cells and dendritic cells, but not for neutrophils. Furthermore, as the only known physiological ligand for CCR8, I-309/CCL1/TCA-3 was identified as a potent inhibitor of HIV-1 envelope-mediated cell-cell fusion and virus infection. I-309/CCL1/TCA-3 induce significant levels of LTC4 from elicited eosinophils.

References
  • Miller MD, et al. (1992) The human cytokine I-309 is a monocyte chemoattractant. Proc Natl Acad Sci. 89 (7): 2950-4.
  • Roos RS, et al. (1997) Identification of CCR8, the receptor for the human CC chemokine I-309. J Biol Chem. 272 (28): 17251-4.
  • Oliveira SH, et al. (2002) Increased responsiveness of murine eosinophils to MIP-1beta (CCL4) and TCA-3 (CCL1) is mediated by their specific receptors, CCR5 and CCR8. J Leukoc Biol. 71(6): 1019-25.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"