I-309 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10057-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All I-309 Reagents
CRO Services

All I-309 Reagents
I-309 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
291 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XhoI (5.5kb + 0.32kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
I-309 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

I-309 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human 4E-BP1/EIF4EBP1 Gene Plasmid Map 7162
I-309 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
I-309 cDNA ORF Clone, Human;P500 cDNA ORF Clone, Human;SCYA1 cDNA ORF Clone, Human;SISe cDNA ORF Clone, Human;TCA3 cDNA ORF Clone, Human
I-309 Background Information

CCL1 or chemokine (C-C motif) ligand 1, also known as I-309 or TCA-3, is a member of the chemokine (C-C motif) ligand family. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. I-309/CCL1/TCA-3 interacts with the G protein-linked transmembrane chemokine receptors CCR8, and induces biochemical events that may result in the control of chemotaxis, proliferation, apoptosis and adhesion. It has been demonstrated that I-309/CCL1/TCA-3 displays chemotactic activity for monocytes and other cell types such as NK cells and dendritic cells, but not for neutrophils. Furthermore, as the only known physiological ligand for CCR8, I-309/CCL1/TCA-3 was identified as a potent inhibitor of HIV-1 envelope-mediated cell-cell fusion and virus infection. I-309/CCL1/TCA-3 induce significant levels of LTC4 from elicited eosinophils.

Full Name
chemokine (C-C motif) ligand 1
References
  • Miller MD, et al. (1992) The human cytokine I-309 is a monocyte chemoattractant. Proc Natl Acad Sci. 89 (7): 2950-4.
  • Roos RS, et al. (1997) Identification of CCR8, the receptor for the human CC chemokine I-309. J Biol Chem. 272 (28): 17251-4.
  • Oliveira SH, et al. (2002) Increased responsiveness of murine eosinophils to MIP-1beta (CCL4) and TCA-3 (CCL1) is mediated by their specific receptors, CCR5 and CCR8. J Leukoc Biol. 71(6): 1019-25.
  • I-309 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    I-309 cDNA ORF Clone in Cloning Vector, Mouse MG50178-M
    I-309 cDNA ORF Clone, Mouse, untagged MG50178-UT
    I-309 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50178-ACG
    I-309 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50178-ACGLN
    I-309 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50178-ACR
    I-309 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50178-CF
    I-309 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50178-NF
    I-309 cDNA ORF Clone, Mouse, C-His tag MG50178-CH
    I-309 cDNA ORF Clone, Mouse, N-His tag MG50178-NH
    I-309 cDNA ORF Clone, Mouse, C-HA tag MG50178-CY
    I-309 cDNA ORF Clone, Mouse, N-HA tag MG50178-NY
    I-309 cDNA ORF Clone, Mouse, C-Myc tag MG50178-CM
    I-309 cDNA ORF Clone, Mouse, N-Myc tag MG50178-NM
    I-309 qPCR Primer Pairs, Mouse MP200208

    I-309 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    I-309 cDNA ORF Clone in Cloning Vector, Human HG10057-M
    I-309 cDNA ORF Clone, Human, untagged HG10057-UT
    I-309 cDNA ORF Clone, Human, C-GFPSpark® tag HG10057-ACG
    I-309 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10057-ACGLN
    I-309 cDNA ORF Clone, Human, C-OFPSpark® tag HG10057-ACR
    I-309 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10057-CF
    I-309 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10057-NF
    I-309 cDNA ORF Clone, Human, C-His tag HG10057-CH
    I-309 cDNA ORF Clone, Human, N-His tag HG10057-NH
    I-309 cDNA ORF Clone, Human, C-HA tag HG10057-CY
    I-309 cDNA ORF Clone, Human, N-HA tag HG10057-NY
    I-309 cDNA ORF Clone, Human, C-Myc tag HG10057-CM
    I-309 cDNA ORF Clone, Human, N-Myc tag HG10057-NM
    I-309 qPCR Primer Pairs, Human HP100145
    info info
    添加购物车成功! 添加购物车失败!