Text Size:AAA

Human CASK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CASKcDNA Clone Product Information
Gene Bank Ref.ID:BC117311
cDNA Size:2697
cDNA Description:ORF Clone of Homo sapiens calcium/calmodulin-dependent serine protein kinase (MAGUK family) DNA.
Gene Synonym:CMG, FGS4, LIN2, TNRC8, CAGH39, CAMGUK, MICPCH, MRXSNA
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Peripheral plasma membrane protein CASK, also known as calcium/calmodulin-dependent serine protein kinase, CASK and LIN2, is a nucleus, cytoplasm and cell membrane protein which belongs to the MAGUK family. CASK / LIN2 contains one guanylate kinase-like domain, two L27 domains, one PDZ (DHR) domain, one protein kinase domain and one SH3 domain. CASK / LIN2 is ubiquitously expressed. Expression of CASK / LIN2 is significantly greater in brain relative to kidney, lung, and liver and in fetal brain and kidney relative to lung and liver. CASK / LIN2 is a multidomain scaffolding protein with a role in synaptic transmembrane protein anchoring and ion channel trafficking. CASK / LIN2 contributes to neural development and regulation of gene expression via interaction with the transcription factor TRB1. It binds to cell-surface proteins, including amyloid precursor protein, neurexins and syndecans. CASK / LIN2 may mediate a link between the extracellular matrix and the actin cytoskeleton via its interaction with syndecan and with the actin/spectrin-binding protein 4.1. Defects in CASK are the cause of mental retardation X-linked CASK-related (MRXCASK). Mental retardation is characterized by significantly below average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Defects in CASK are also the cause of FG syndrome type 4 which is an X-linked disorder characterized by mental retardation, relative macrocephaly, hypotonia and constipation.

References
  • Cohen A.R., et al., 1998, J. Cell Biol. 142:129-138.
  • Bhalla K., et al., 2008, Am. J. Hum. Genet. 83:703-713.
  • Mukherjee K., et al., 2008, Cell 133: 328-339.
  • Najm J., et al., 2008, Nat. Genet. 40:1065-1067.
  • Piluso G., et al., 2009, Am. J. Hum. Genet. 84:162-177.
  • Tarpey P.S., et al., 2009, Nat. Genet. 41:535-543.
  • Catalog:HG11913-G-N
    List Price: $545.00  (Save $150.00)
    Price:$395.00      [How to order]
    Availability5 business days
    Images
    • Human CASK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"