Quick Order

Human CACNG4 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CACNG4 cDNA Clone Product Information
NCBI RefSeq:BC034532
RefSeq ORF Size:984bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium channel, voltage-dependent, gamma subunit 4.
Gene Synonym:CACNG4
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-CACNG4
Restriction Site:HindIII + XbaI (5.5kb + 0.98kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CACNG4 qPCR primers for gene expression analysis, HP104819 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CACNG4 Gene Plasmid Map
Human CACNG4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human CACNG4 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG12499-G-N
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry
Contact Us
Images
  • Human CACNG4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"