Quick Order

DatasheetReviewsRelated ProductsProtocols
Human C2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human C2 Gene Plasmid Map
Human C2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Complement component C2 is part of the classical complement pathway which plays a major role in innate immunity against infection. C2 is a glycoprotein synthesized in liver hepatocytes and several other cell types in extrahepatic tissues. This pathway is triggered by a multimolecular complex C1, and subsequently the single-chain form of C2 is cleaved into two chains referred to C2a and C2b by activated C1. The second component of complement (C2) is a multi-domain serine protease that provides catalytic activity for the C3 and C5 convertases of the classical and lectin pathways of human complement. C4b and C2 was investigated by surface plasmon resonance. C2a containing a serine protease domain combines with complement component C4b to form the C3 convertase C4b2a which is responsible for C3 activation, and leads to the stimulation of adaptive immune responses via Lectin pathway. C2 bound to C4b is cleaved by classical (C1s) or lectin (MASP2) proteases to produce C4bC2a. C2 has the same serine protease domain as C4bC2a but in an inactive zymogen-like conformation, requiring cofactor-induced conformational change for activity. Deficiency of C2 (C2D) is the most common genetic deficiency of the complement system, and two types of C2D have been recognized in the context of specific MHC haplotypes. C2D in human is reported to increase susceptibility to infection, and is associated with certain autoimmune diseases, such as rheumatological disorders.

  • Laich A, et al. (2002) Complement C4bC2 complex formation: an investigation by surface plasmon resonance. Biochim Biophys Acta. 1544(1-2): 96-112.
  • Halili MA, et al. (2009) Complement component C2, inhibiting a latent serine protease in the classical pathway of complement activation. Biochemistry. 48(35): 8466-72.
  • Krishnan V, et al. (2009) The structure of C2b, a fragment of complement component C2 produced during C3 convertase formation. Acta Crystallogr D Biol Crystallogr. 65(Pt 3): 266-74.
  • Contact Us
    • Human C2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.