Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Bcl-2/BCL2cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Other Bcl-2/BCL2 Protein Products
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, C-GFPSpark tagHG10195-ACGJPY0
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10195-ACRJPY34290
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, N-GFPSpark tagHG10195-ANGJPY34290
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10195-ANRJPY34290
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, C-Flag tagHG10195-CFJPY31120
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, C-His tagHG10195-CHJPY31120
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, C-Myc tagHG10195-CMJPY31120
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, C-HA tagHG10195-CYJPY31120
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA clone plasmidHG10195-MJPY10020
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, N-Flag tagHG10195-NFJPY31120
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, N-His tagHG10195-NHJPY31120
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, N-Myc tagHG10195-NMJPY31120
Human Bcl-2 / BCL2 transcript variant alpha ORF mammalian expression plasmid, N-HA tagHG10195-NYJPY31120
Human Bcl-2 / BCL2 transcript variant alpha natural ORF mammalian expression plasmidHG10195-UTJPY31120
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

References
  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"