Quick Order

Human B Raf Gene ORF cDNA clone expression plasmid, C-His tag

  • Human BRAF Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
DatasheetReviewsRelated ProductsProtocols
Human BRAF cDNA Clone Product Information
NCBI RefSeq:NM_004333.4
RefSeq ORF Size:2301bp
cDNA Description:Full length Clone DNA of Homo sapiens v-raf murine sarcoma viral oncogene homolog B1 with His tag.
Gene Synonym:BRAF1, RAFB1, B-RAF1, FLJ95109, MGC126806, MGC138284
Species:Human
Vector:pCMV/hygro-His
Plasmid:pCMV-BRAF-10his
Restriction Site:HindIII + XbaI (5.5kb + 2.33kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 6 G/T and 2295 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with BRAF qPCR primers for gene expression analysis, HP101484 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BRAF Gene Plasmid Map
Human BRAF Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
Immunochemical staining of human CCNF in human brain with rabbit polyclonal antibody (1 µg/mL, formalin-fixed paraffin embedded sections).
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.
  • Size / Price
    Catalog: HG11632-M-H
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"