_×
Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged (Cytokine)

Catalog Vector (Price) Quantity In Stock Operation
HG10083-M-F
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

BMP7 cDNA Clone Datasheet

 

BMP7 cDNA Clone Product Information

Gene Bank Ref.ID:

NM_001719.2

cDNA Size:

1296

Gene Synonym:

BMP7, OP-1

Source: Human

BMP7 cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens bone morphogenetic protein 7 DNA.

Vector:

pCMV/hygro-FLAG

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

BMP7 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

BMP7 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

BMP7 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGCACGTGC GCTCACTGCG AGCTGCGGCG CCGCACAGCT TCGTGGCGCT CTGGGCACCC
61       CTGTTCCTGC TGCGCTCCGC CCTGGCCGAC TTCAGCCTGG ACAACGAGGT GCACTCGAGC
121      TTCATCCACC GGCGCCTCCG CAGCCAGGAG CGGCGGGAGA TGCAGCGCGA GATCCTCTCC
181      ATTTTGGGCT TGCCCCACCG CCCGCGCCCG CACCTCCAGG GCAAGCACAA CTCGGCACCC
241      ATGTTCATGC TGGACCTGTA CAACGCCATG GCGGTGGAGG AGGGCGGCGG GCCCGGCGGC
301      CAGGGCTTCT CCTACCCCTA CAAGGCCGTC TTCAGTACCC AGGGCCCCCC TCTGGCCAGC
361      CTGCAAGATA GCCATTTCCT CACCGACGCC GACATGGTCA TGAGCTTCGT CAACCTCGTG
421      GAACATGACA AGGAATTCTT CCACCCACGC TACCACCATC GAGAGTTCCG GTTTGATCTT
481      TCCAAGATCC CAGAAGGGGA AGCTGTCACG GCAGCCGAAT TCCGGATCTA CAAGGACTAC
541      ATCCGGGAAC GCTTCGACAA TGAGACGTTC CGGATCAGCG TTTATCAGGT GCTCCAGGAG
601      CACTTGGGCA GGGAATCGGA TCTCTTCCTG CTCGACAGCC GTACCCTCTG GGCCTCGGAG
661      GAGGGCTGGC TGGTGTTTGA CATCACAGCC ACCAGCAACC ACTGGGTGGT CAATCCGCGG
721      CACAACCTGG GCCTGCAGCT CTCGGTGGAG ACGCTGGATG GGCAGAGCAT CAACCCCAAG
781      TTGGCGGGCC TGATTGGGCG GCACGGGCCC CAGAACAAGC AGCCCTTCAT GGTGGCTTTC
841      TTCAAGGCCA CGGAGGTCCA CTTCCGCAGC ATCCGGTCCA CGGGGAGCAA ACAGCGCAGC
901      CAGAACCGCT CCAAGACGCC CAAGAACCAG GAAGCCCTGC GGATGGCCAA CGTGGCAGAG
961      AACAGCAGCA GCGACCAGAG GCAGGCCTGT AAGAAGCACG AGCTGTATGT CAGCTTCCGA
1021     GACCTGGGCT GGCAGGACTG GATCATCGCG CCTGAAGGCT ACGCCGCCTA CTACTGTGAG
1081     GGGGAGTGTG CCTTCCCTCT GAACTCCTAC ATGAACGCCA CCAACCACGC CATCGTGCAG
1141     ACGCTGGTCC ACTTCATCAA CCCGGAAACG GTGCCCAAGC CCTGCTGTGC GCCCACGCAG
1201     CTCAATGCCA TCTCCGTCCT CTACTTCGAT GACAGCTCCA ACGTCATCCT GAAGAAATAC
1261     AGAAACATGG TGGTCCGGGC CTGTGGCTGC CACGCT1GATT ACAAGGATGA CGACGATAAG2
1321     TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. FLAG Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 

All TGF-beta Proteins

Product name Product name
ACVR2B / ActivinR-IIB Protein ALK4 / ACVR1B Protein
ALK-2 / ACVR1 ProteinMouse GDF10 / BMP-3B Protein (Fc Tag)
ACVR2 / ACTRII / ACVR2A ProteinMouse Activin A Protein (His Tag)
BMP-2 ProteinTGFB2 / TGF-beta 2 Protein (Latent) (His Tag)
BMP-5 ProteinMouse TGFBR3 / Betaglycan Protein (His Tag)
BMPRIA / ALK-3 / CD292 ProteinATF2 Protein (GST Tag)
BMPR-II ProteinALK-2 / ACVR1 / ALK2 Protein (His Tag)
Endoglin / CD105 / ENG ProteinHuman / Rhesus / Canine TGFβ1 / TGFB1 Protein (Native)
TGFβR2 / TGFR2 ProteinRat TDGF1 / CRGF Protein
Mouse ALK-3 / BMPR1A ProteinBMPR1B / ALK6 (149-502) Protein (GST Tag)
Lefty A ProteinRat TGFBR2 Protein
Mouse ACVR2B ProteinCynomolgus ACVR1B / ALK-4 Protein
ACVR2B / ActivinR-IIB Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein
BMPR-II Protein (His Tag)Cynomolgus TGFBR2 Protein
GDF-15 ProteinCynomolgus ALK-7 / ALK7 / ACVR1C Protein
Mouse ALK-2 / ACVR1 ProteinCynomolgus ALK-2 / ACVR1 / ALK2 Protein
Activin A Protein (His Tag)TGFBR1 / ALK-5 / SKR4 (aa 200-503) Protein (GST Tag)
latent TGFβ1 Protein (His Tag)Danio rerio (zebrafish) BMP-2 / BMP2A Protein (Native)
BMP-2 / BMP2A Protein (Native)Rat ACVR1B / ALK-4 Protein
Activin B Protein (His Tag)BMPR1B / ALK6 Protein
TGFB1 / TGF-beta1 Protein (Native)TGFBR3 / Betaglycan Protein (His Tag)
Mouse ACTRIIB / ACVR2B Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein
ALK4 / ACVR1B Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)
TGFBR1 / ALK-5 / SKR4 ProteinCanine GFRA1 / GFR alpha-1 Protein (His Tag)
Mouse ALK-3 / BMPR1A Protein (His Tag)Rat GFRA1 / GFR alpha-1 Protein
Endoglin / CD105 / ENG Protein (His Tag)Cynomolgus ACVR2B / ACTRIIB Protein (His Tag)
TDGF1 / CRGF Protein (His Tag)Rat NCAM1 / CD56 Protein (His Tag)
Mouse ACVR2A / ActrIIa Protein (His Tag)Mouse GFRA3 / GFR-alpha-3 Protein (His Tag)
Mouse ACVR2A / ActrIIa ProteinRat TDGF1 / CRGF Protein (His Tag)
Mouse Endoglin / ENG / CD105 Protein (His Tag)Cynomolgus ACVR2B / ACTRIIB Protein
Mouse MSTN / GDF8 ProteinRat TGFβ1 / TGFB1 Protein (His Tag)
ACVR2 / ACTRII / ACVR2A Protein (His Tag)Cynomolgus ACVR2B / ACTRIIB Protein
BMPRIA / ALK-3 / CD292 Protein (His Tag)Mouse TGFβ1 / TGFB1 Protein (His Tag)

All TGF-beta Antibodies

Product name Product name
BMPR2 / BMPR-II / PPH1 Antibody ALK-3 / BMPR-1A / CD292 Antibody (Antigen Affinity Purified)
BMPR2 / BMPR-II / PPH1 Antibody (Antigen Affinity Purified)Endoglin / CD105 / ENG Antibody
TGF-beta1 / TGFB1 AntibodyEndoglin / CD105 Antibody ( FITC )
TGF-beta1 / TGFB1 Antibody (Antigen Affinity Purified)Endoglin / CD105 Antibody ( FITC )
TGF-beta1 / TGFB1 Antibody (Mouse Monoclonal Antibody)Endoglin / CD105 / ENG Antibody
TGF-beta1 / TGFB1 AntibodyTGF-beta 1 Antibody
ACVR2B / ACTRIIB AntibodyBMP-2 Antibody
ACVR2B / ACTRIIB Antibody (Antigen Affinity Purified)Endoglin / CD105 Antibody
Endoglin / CD105 / ENG AntibodyACVR2B / ACTRIIB Antibody
Endoglin / CD105 / ENG Antibody (Antigen Affinity Purified)ACVR2A Antibody
ACVR1B / ALK4 AntibodyACVR2A Antibody (Antigen Affinity Purified)
Endoglin / ENG / CD105 AntibodyTGFBR3 Antibody
Endoglin / ENG / CD105 Antibody (Antigen Affinity Purified)TGFBR3 Antibody (Antigen Affinity Purified)
Endoglin / CD105 / ENG AntibodyALK-3 / BMPRIA Antibody
Endoglin / CD105 / ENG AntibodyBMP-7 Antibody
BMPR2 / BMPR-II / PPH1 AntibodyInhibin beta A / INHBA Antibody
ACVR2B / ACTRIIB AntibodyGFRA1 Antibody
ALK-3 / BMPR-1A / CD292 AntibodyTGFBR3 Antibody
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"