Text Size:AAA

Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BMP-7cDNA Clone Product Information
Gene Bank Ref.ID:NM_001719.2
cDNA Size:1296
cDNA Description:ORF Clone of Homo sapiens bone morphogenetic protein 7 DNA.
Gene Synonym:BMP7, OP-1
Species:Human
Vector:pCMV/hygro-FLAG
Restriction Site:KpnI + XbaI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

pCMV/hygro-FLAG vector information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro-FLAG Physical Map
Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG tag info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Mouse Smad5 ProteinCanine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse BAMBI / NMA Protein (Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human TGFBR3 / Betaglycan Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinMouse Smad3 Protein (His & GST Tag)Human TGFBR2 Protein (His & Fc Tag)Human Latent TGF-beta 2 / TGFB2 Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)
Background
Catalog:HG10083-M-F
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
5 business days
Images
  • Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"