Quick Order

DatasheetReviewsRelated ProductsProtocols
Human BMP-7 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human BMP-7 Gene Plasmid Map
Human BMP-7 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

BMP-7 (Bone morphogenetic protein 7), also known as osteogenic protein 1 (OP-1), is a bone morphogenetic protein which belongs to the TGF-β superfamily. OP-1 is expressed in the brain, kidneys and bladder. BMP-7 may be involved in bone homeostasis. Osteogenic protein 1 plays a key role in the transformation of mesenchymal cells into bone and cartilage. The phosphorylation of SMAD1 and SMAD5 can be induced by BMP-7, which in turn induce transcription of numerous osteogenic genes. BMP-7 treatment can also induce all of the genetic markers of osteoblast differentiation in many cell types. The expression of BMP-7 causes ventral phenotypes while its complete inhibition creates a dorsal phenotype. Human recombinant BMP-7 protein can be used to aid in the fusion of vertebral bodies to prevent neurologic trauma. It also functions in the treatment of tibial non-union, frequently in cases where a bone graft has failed. It is found that BMP7 has the potential for treatment of chronic kidney disease.

  • Shi J. et al., 2010, Fertil Steril. 93(4): 1273-9.
  • González EA. et al., 2002, Kidney Int. 61(4): 1322-31.
  • Gould SE. et al., 2002, Kidney Int. 61(1): 51-60.
  • Hahn GV. et al., 1992, Genomics. 14(3): 759-62.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.