Quick Order

Text Size:AAA

Human BMP-5 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BMP-5 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for 846C/T mutation not resulting in amino acid variation.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human BMP-5 Gene Plasmid Map
Human BMP-5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs) which constitute a novel subfamily of the transforming growth factor β (TGF-β) superfamily. In agreement with a possible role in the control of cell death, BMP-5 exhibited a regulated pattern of expression in the interdigital tissue. Transcripts of BMP-5 and BMP-5 protein were abundant within the cytoplasm of the fragmenting apoptotic interdigital cells in a way suggesting that delivery of BMPs into the tissue is potentiated during apoptosis. Gain-of-function experiments demonstrated that BMP-5 has the same effect as other interdigital BMPs inducing apoptosis in the undifferentiated mesoderm and growth in the prechondrogenic mesenchyme. BMP-5 is a member of the 60A subgroup of BMPs, other members of which have been shown to stimulate dendritic growth in central and peripheral neurons. The signaling pathway that mediates the dendrite-promoting activity of BMP-5 may involve binding to BMPR-IA and activation of Smad-1, and relative levels of BMP antagonists such as noggin and follistatin may modulate BMP-5 signaling. Since BMP-5 is expressed at relatively high levels not only in the developing but also the adult nervous system, these findings suggest the possibility that BMP-5 regulates dendritic morphology not only in the developing, but also the adult nervous system. BMP-5 may play important roles not only in myocardial differentiation, but also in the formation and maintenance of endocardial cushion tissue. Additionally, high expression level of BMP-5 has been detected in certain tumors of mesenchymal origin.

  • Yamagishi T, et al. (2001) Expression of bone morphogenetic protein-5 gene during chick heart development: possible roles in valvuloseptal endocardial cushion formation. Anat Rec. 264(4): 313-6.
  • Beck HN, et al. (2001) Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci. 2:12.
  • Zuzarte-Lus V, et al. (2004) A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 272(1): 39-52.
  • Contact Us
    • Human BMP-5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.