In observance of Chinese Independence Day, we will not be able to arrange any shipment from October 1st to October 6th due to the closure of Chinese Customs offices.
Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BMP-2cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Other BMP-2 Protein Products
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • Size / Price
    • Human BMP-2 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    Recently Viewed Items