After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BAFF / TNFSF13B ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human BAFF cDNA Clone Product Information
NCBI RefSeq:NM_006573.3
RefSeq ORF Size:858bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 13b with Flag tag.
Restriction Site:KpnI + XhoI (5.5kb + 0.89kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BAFF Gene Plasmid Map
Human BAFF / TNFSF13B Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human BAFF Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human BAFF / TNFSF13B natural ORF mammalian expression plasmid, Flag tag
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.
  • Images
    • Human BAFF / TNFSF13B Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    • Human BAFF / TNFSF13B natural ORF mammalian expression plasmid, Flag tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.