BAFF cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10056-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BAFF Reagents
CRO Services

All BAFF Reagents
BAFF cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
858 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 13b with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.89kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
BAFF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAFF cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human BAFF/BLyS/TNFSF13B Gene Expression validated Image 2383
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
BAFF cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
BAFF cDNA ORF Clone, Human;BLYS cDNA ORF Clone, Human;CD257 cDNA ORF Clone, Human;DTL cDNA ORF Clone, Human;TALL-1 cDNA ORF Clone, Human;TALL1 cDNA ORF Clone, Human;THANK cDNA ORF Clone, Human;TNFSF20 cDNA ORF Clone, Human;ZTNF4 cDNA ORF Clone, Human
BAFF Background Information

B lymphocyte stimulator (BLyS), also known as TNFSF13B, CD257 and BAFF, is single-pass type II membrane protein, which belongs to the tumor necrosis factor family. BAFF is abundantly expressed in peripheral blood Leukocytes and is specifically expressed in monocytes and macrophages. BAFF is a cytokine and serves as a ligand for receptors TNFRSF13B (TACI), TNFRSF17 (BCMA), and TNFRSF13C (BAFFR). These receptors is a prominent factor in B cell differentiation, homeostasis, and selection. BLyS levels affect survival signals and selective apoptosis of autoantibody-producing B cells. Thus, it acts as a potent B cell activator and has been shown to play an important role in the proliferation and differentiation of B cells. Overexpression of BLyS in mice can lead to clinical and serological features of systemic lupus erythematosus (SLE) and Sjögren's syndrome (SS). BLyS as an attractive therapeutic target in human rheumatic diseases. The ability of BLyS to regulate both the size and repertoire of the peripheral B cell compartment raises the possibility that BLyS and antagonists thereof may form the basis of a therapeutic trichotomy. As an agonist, BLyS protein may enhance humoral immunity in congenital or acquired immunodeficiencies such as those resulting from viral infection or cancer therapy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 13b
Research Areas
References
  • Nardelli B, et al. (2002) B lymphocyte stimulator (BLyS): a therapeutic trichotomy for the treatment of B lymphocyte diseases. Leuk Lymphoma. 43(7): 1367-73.
  • Stohl W. (2006) Therapeutic targeting of B lymphocyte stimulator (BLyS) in the rheumatic diseases. Endocr Metab Immune Disord Drug Targets. 6(4): 51-8.
  • Cancro MP, et al. (2009) The role of B lymphocyte stimulator (BLyS) in systemic lupus erythematosus. J Clin Invest. 119(5): 1066-73.
  • BAFF cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Rhesus CG90267-G
    BAFF cDNA ORF Clone, Rhesus, untagged CG90267-UT
    BAFF Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90267-ACGLN
    BAFF cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90267-ACG
    BAFF cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90267-ACR
    BAFF cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90267-CF
    BAFF cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90267-NF
    BAFF cDNA ORF Clone, Rhesus, C-His tag CG90267-CH
    BAFF cDNA ORF Clone, Rhesus, N-His tag CG90267-NH
    BAFF cDNA ORF Clone, Rhesus, C-HA tag CG90267-CY
    BAFF cDNA ORF Clone, Rhesus, N-HA tag CG90267-NY
    BAFF cDNA ORF Clone, Rhesus, C-Myc tag CG90267-CM
    BAFF cDNA ORF Clone, Rhesus, N-Myc tag CG90267-NM

    BAFF cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Canine DG70112-G

    BAFF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Mouse MG50352-M
    BAFF cDNA ORF Clone, Mouse, untagged MG50352-UT
    BAFF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50352-ACG
    BAFF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50352-ACGLN
    BAFF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50352-ACR
    BAFF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50352-CF
    BAFF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50352-NF
    BAFF cDNA ORF Clone, Mouse, C-His tag MG50352-CH
    BAFF cDNA ORF Clone, Mouse, N-His tag MG50352-NH
    BAFF cDNA ORF Clone, Mouse, C-HA tag MG50352-CY
    BAFF cDNA ORF Clone, Mouse, N-HA tag MG50352-NY
    BAFF cDNA ORF Clone, Mouse, C-Myc tag MG50352-CM
    BAFF cDNA ORF Clone, Mouse, N-Myc tag MG50352-NM
    BAFF qPCR Primer Pairs, Mouse MP200373

    BAFF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BAFF cDNA ORF Clone in Cloning Vector, Human HG10056-M
    BAFF cDNA ORF Clone, Human, untagged HG10056-UT
    BAFF cDNA ORF Clone, Human, C-GFPSpark® tag HG10056-ACG
    BAFF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10056-ACGLN
    BAFF cDNA ORF Clone, Human, C-OFPSpark® tag HG10056-ACR
    BAFF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10056-CF
    BAFF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10056-NF
    BAFF cDNA ORF Clone, Human, C-His tag HG10056-CH
    BAFF cDNA ORF Clone, Human, N-His tag HG10056-NH
    BAFF cDNA ORF Clone, Human, C-HA tag HG10056-CY
    BAFF cDNA ORF Clone, Human, N-HA tag HG10056-NY
    BAFF cDNA ORF Clone, Human, C-Myc tag HG10056-CM
    BAFF cDNA ORF Clone, Human, N-Myc tag HG10056-NM
    BAFF qPCR Primer Pairs, Human HP100144
    info info
    添加购物车成功! 添加购物车失败!