Customer experience is always our first concern. Purchase can be made in your local currency now. Explore our website for more!
Text Size:AAA

Human BACE1 / ASP2 transcript variant a ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human BACE1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human BACE1 Gene Plasmid Map
Human BACE1 / ASP2 transcript variant a Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral nerve cells. In the brain, This protein is expressed highly in the substantia nigra, locus coruleus and medulla oblongata. Strong BACE1 expression has also been described in pancreatic tissue. BACE1 has a pivotal role in the pathogenesis of Alzheimer's disease. In Alzheimer's disease patients, BACE1 levels were elevated although mRNA levels were not changed. It has been found that BACE1 gene expression is controlled by a TATA-less promoter. The translational repression as a new mechanism controlling its expression. And the low concentrations of Ca(2+) (microM range) significantly increased the proteolytic activity of BACE1. Furthermore, BACE1 protein is ubiquitinated, and the degradation of BACE1 proteins and amyloid precursor protein processing are regulated by the ubiquitin-proteasome pathway. It has also been identified as the rate limiting enzyme for amyloid-beta-peptide (Abeta) production.

  • Christensen MA, et al. (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol. 24(2):865-74.
  • Stockley JH, et al. (2007) The proteins BACE1 and BACE2 and beta-secretase activity in normal and Alzheimer's disease brain. Biochem Soc Trans. 35(Pt 3): 574-6.
  • Savonenko AV, et al. (2008) Alteration of BACE1-dependent NRG1/ErbB4 signaling and schizophrenia-like phenotypes in BACE1-null mice. Proc Natl Acad Sci U S A. 105(14): 5585-90.
  • Hayley M, et al. (2009) Calcium enhances the proteolytic activity of BACE1: An in vitro biophysical and biochemical characterization of the BACE1-calcium interaction. Biochim Biophys Acta. 1788(9): 1933-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.