_×
Human BACE1 / ASP2 transcript variant a Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human BACE1 / ASP2 transcript variant a Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Human BACE1 / ASP2 transcript variant a Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG10064-M-F
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

BACE1 / ASP2 transcript variant a cDNA Clone Datasheet

 

BACE1 / ASP2 transcript variant a cDNA Clone Product Information

Gene Bank Ref.ID:

AF_190725

cDNA Size:

1506

Gene Synonym:

BACE1, ASP2, BACE, HSPC104, FLJ90568, KIAA1149

Source: Human

BACE1 / ASP2 transcript variant a cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens beta-site APP-cleaving enzyme 1 (BACE1), transcript variant a DNA.

Vector:

pCMV/hygro-FLAG

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

BACE1 / ASP2 transcript variant a cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

BACE1 / ASP2 transcript variant a cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

BACE1 / ASP2 transcript variant a cDNA Clone Sequence and Quality Control

Sequence:

1        ATGGCCCAAG CCCTGCCCTG GCTCCTGCTG TGGATGGGCG CGGGAGTGCT GCCTGCCCAC
61       GGCACCCAGC ACGGCATCCG GCTGCCCCTG CGCAGCGGCC TGGGGGGCGC CCCCCTGGGG
121      CTGCGGCTGC CCCGGGAGAC CGACGAAGAG CCCGAGGAGC CCGGCCGGAG GGGCAGCTTT
181      GTGGAGATGG TGGACAACCT GAGGGGCAAG TCGGGGCAGG GCTACTACGT GGAGATGACC
241      GTGGGCAGCC CCCCGCAGAC GCTCAACATC CTGGTGGATA CAGGCAGCAG TAACTTTGCA
301      GTGGGTGCTG CCCCCCACCC CTTCCTGCAT CGCTACTACC AGAGGCAGCT GTCCAGCACA
361      TACCGGGACC TCCGGAAGGG TGTGTATGTG CCCTACACCC AGGGCAAGTG GGAAGGGGAG
421      CTGGGCACCG ACCTGGTAAG CATCCCCCAT GGCCCCAACG TCACTGTGCG TGCCAACATT
481      GCTGCCATCA CTGAATCAGA CAAGTTCTTC ATCAACGGCT CCAACTGGGA AGGCATCCTG
541      GGGCTGGCCT ATGCTGAGAT TGCCAGGCCT GACGACTCCC TGGAGCCTTT CTTTGACTCT
601      CTGGTAAAGC AGACCCACGT TCCCAACCTC TTCTCCCTGC AGCTTTGTGG TGCTGGCTTC
661      CCCCTCAACC AGTCTGAAGT GCTGGCCTCT GTCGGAGGGA GCATGATCAT TGGAGGTATC
721      GACCACTCGC TGTACACAGG CAGTCTCTGG TATACACCCA TCCGGCGGGA GTGGTATTAT
781      GAGGTGATCA TTGTGCGGGT GGAGATCAAT GGACAGGATC TGAAAATGGA CTGCAAGGAG
841      TACAACTATG ACAAGAGCAT TGTGGACAGT GGCACCACCA ACCTTCGTTT GCCCAAGAAA
901      GTGTTTGAAG CTGCAGTCAA ATCCATCAAG GCAGCCTCCT CCACGGAGAA GTTCCCTGAT
961      GGTTTCTGGC TAGGAGAGCA GCTGGTGTGC TGGCAAGCAG GCACCACCCC TTGGAACATT
1021     TTCCCAGTCA TCTCACTCTA CCTAATGGGT GAGGTTACCA ACCAGTCCTT CCGCATCACC
1081     ATCCTTCCGC AGCAATACCT GCGGCCAGTG GAAGATGTGG CCACGTCCCA AGACGACTGT
1141     TACAAGTTTG CCATCTCACA GTCATCCACG GGCACTGTTA TGGGAGCTGT TATCATGGAG
1201     GGCTTCTACG TTGTCTTTGA TCGGGCCCGA AAACGAATTG GCTTTGCTGT CAGCGCTTGC
1261     CATGTGCACG ATGAGTTCAG GACGGCAGCG GTGGAAGGCC CTTTTGTCAC CTTGGACATG
1321     GAAGACTGTG GCTACAACAT TCCACAGACA GATGAGTCAA CCCTCATGAC CATAGCCTAT
1381     GTCATGGCTG CCATCTGCGC CCTCTTCATG CTGCCACTCT GCCTCATGGT GTGTCAGTGG
1441     CGCTGCCTCC GCTGCCTGCG CCAGCAGCAT GATGACTTTG CTGATGACAT CTCCCTGCTG
1501     AAGGCT1GATT ACAAGGATGA CGACGATAAG2 TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. FLAG Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"