BACE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10064-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BACE1 Reagents
CRO Services

All BACE1 Reagents
BACE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human beta-site APP-cleaving enzyme 1 (BACE1), transcript variant a DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
BACE1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BACE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human BACE1 Gene Plasmid Map 7171
BACE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ASP2 cDNA ORF Clone, Human;BACE cDNA ORF Clone, Human;HSPC104 cDNA ORF Clone, Human
BACE1 Background Information

Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral nerve cells. In the brain, This protein is expressed highly in the substantia nigra, locus coruleus and medulla oblongata. Strong BACE1 expression has also been described in pancreatic tissue. BACE1 has a pivotal role in the pathogenesis of Alzheimer's disease. In Alzheimer's disease patients, BACE1 levels were elevated although mRNA levels were not changed. It has been found that BACE1 gene expression is controlled by a TATA-less promoter. The translational repression as a new mechanism controlling its expression. And the low concentrations of Ca(2+) (microM range) significantly increased the proteolytic activity of BACE1. Furthermore, BACE1 protein is ubiquitinated, and the degradation of BACE1 proteins and amyloid precursor protein processing are regulated by the ubiquitin-proteasome pathway. It has also been identified as the rate limiting enzyme for amyloid-beta-peptide (Abeta) production.

Full Name
beta-site APP-cleaving enzyme 1
References
  • Christensen MA, et al. (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol. 24(2):865-74.
  • Stockley JH, et al. (2007) The proteins BACE1 and BACE2 and beta-secretase activity in normal and Alzheimer's disease brain. Biochem Soc Trans. 35(Pt 3): 574-6.
  • Savonenko AV, et al. (2008) Alteration of BACE1-dependent NRG1/ErbB4 signaling and schizophrenia-like phenotypes in BACE1-null mice. Proc Natl Acad Sci U S A. 105(14): 5585-90.
  • Hayley M, et al. (2009) Calcium enhances the proteolytic activity of BACE1: An in vitro biophysical and biochemical characterization of the BACE1-calcium interaction. Biochim Biophys Acta. 1788(9): 1933-8.
  • BACE1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BACE1 cDNA ORF Clone in Cloning Vector, Mouse MG50002-M
    BACE1 cDNA ORF Clone, Mouse, untagged MG50002-UT
    BACE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50002-ACG
    BACE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50002-ACGLN
    BACE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50002-ACR
    BACE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50002-CF
    BACE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50002-NF
    BACE1 cDNA ORF Clone, Mouse, C-His tag MG50002-CH
    BACE1 cDNA ORF Clone, Mouse, N-His tag MG50002-NH
    BACE1 cDNA ORF Clone, Mouse, C-HA tag MG50002-CY
    BACE1 cDNA ORF Clone, Mouse, N-HA tag MG50002-NY
    BACE1 cDNA ORF Clone, Mouse, C-Myc tag MG50002-CM
    BACE1 cDNA ORF Clone, Mouse, N-Myc tag MG50002-NM
    BACE1 qPCR Primer Pairs, Mouse MP200002

    BACE1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BACE1 cDNA ORF Clone in Cloning Vector, Human HG10064-M
    BACE1 cDNA ORF Clone, Human, untagged HG10064-UT
    BACE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10064-ACGLN
    BACE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10064-ACG
    BACE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10064-ACR
    BACE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10064-CF
    BACE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10064-NF
    BACE1 cDNA ORF Clone, Human, C-His tag HG10064-CH
    BACE1 cDNA ORF Clone, Human, N-His tag HG10064-NH
    BACE1 cDNA ORF Clone, Human, C-HA tag HG10064-CY
    BACE1 cDNA ORF Clone, Human, N-HA tag HG10064-NY
    BACE1 cDNA ORF Clone, Human, C-Myc tag HG10064-CM
    BACE1 cDNA ORF Clone, Human, N-Myc tag HG10064-NM
    BACE1 qPCR Primer Pairs, Human HP100048
    info info
    添加购物车成功! 添加购物车失败!