_×
Human B2M Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human B2M Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Human B2M Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG11976-G-F
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

B2M cDNA Clone Datasheet

 

B2M cDNA Clone Product Information

Gene Bank Ref.ID:

NM_004048

cDNA Size:

360

Gene Synonym:

B2M

Source: Human

B2M cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens beta-2-microglobulin DNA.

Vector:

pCMV/hygro-FLAG

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description: Identical with the Gene Bank Ref.ID sequence.

B2M cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

B2M cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

B2M cDNA Clone Sequence and Quality Control

Sequence:

1        ATGTCTCGCT CCGTGGCCTT AGCTGTGCTC GCGCTACTCT CTCTTTCTGG CCTGGAGGCT
61       ATCCAGCGTA CTCCAAAGAT TCAGGTTTAC TCACGTCATC CAGCAGAGAA TGGAAAGTCA
121      AATTTCCTGA ATTGCTATGT GTCTGGGTTT CATCCATCCG ACATTGAAGT TGACTTACTG
181      AAGAATGGAG AGAGAATTGA AAAAGTGGAG CATTCAGACT TGTCTTTCAG CAAGGACTGG
241      TCTTTCTATC TCTTGTACTA CACTGAATTC ACCCCCACTG AAAAAGATGA GTATGCCTGC
301      CGTGTGAACC ATGTGACTTT GTCACAGCCC AAGATAGTTA AGTGGGATCG AGACATGGCT1
361      GATTACAAGG ATGACGACGA TAAG2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. FLAG Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"