ARHGAP1 cDNA ORF Clone, Human, untagged

Cat: HG12520-G-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARHGAP1 Reagents
CRO Services

All ARHGAP1 Reagents
ARHGAP1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1320 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Rho GTPase activating protein 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ARHGAP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARHGAP1 cDNA ORF Clone, Human, untagged Validated Images
Human MMP2/MMP-2/CLG4A Gene Plasmid Map 7152
ARHGAP1 cDNA ORF Clone, Human, untagged Alternative Names
CDC42GAP cDNA ORF Clone, Human;p50rhoGAP cDNA ORF Clone, Human;RHOGAP cDNA ORF Clone, Human;RHOGAP1 cDNA ORF Clone, Human
ARHGAP1 Background Information
Full Name
Rho GTPase activating protein 1

ARHGAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARHGAP1 cDNA ORF Clone in Cloning Vector, Rat RG81018-U
ARHGAP1 cDNA ORF Clone, Rat, untagged RG81018-UT
ARHGAP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81018-ACG
ARHGAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81018-ACGLN
ARHGAP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81018-ANG
ARHGAP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81018-ACR
ARHGAP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81018-ANR
ARHGAP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81018-CF
ARHGAP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81018-NF
ARHGAP1 cDNA ORF Clone, Rat, C-His tag RG81018-CH
ARHGAP1 cDNA ORF Clone, Rat, N-His tag RG81018-NH
ARHGAP1 cDNA ORF Clone, Rat, C-HA tag RG81018-CY
ARHGAP1 cDNA ORF Clone, Rat, N-HA tag RG81018-NY
ARHGAP1 cDNA ORF Clone, Rat, C-Myc tag RG81018-CM
ARHGAP1 cDNA ORF Clone, Rat, N-Myc tag RG81018-NM
ARHGAP1 qPCR Primer Pairs, Rat RP300982

ARHGAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARHGAP1 cDNA ORF Clone in Cloning Vector, Human HG16685-U
ARHGAP1 cDNA ORF Clone, Human, untagged HG16685-UT
ARHGAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16685-ACG
ARHGAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16685-ACGLN
ARHGAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16685-ANG
ARHGAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16685-ACR
ARHGAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16685-ANR
ARHGAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16685-CF
ARHGAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16685-NF
ARHGAP1 cDNA ORF Clone, Human, C-His tag HG16685-CH
ARHGAP1 cDNA ORF Clone, Human, N-His tag HG16685-NH
ARHGAP1 cDNA ORF Clone, Human, C-HA tag HG16685-CY
ARHGAP1 cDNA ORF Clone, Human, N-HA tag HG16685-NY
ARHGAP1 cDNA ORF Clone, Human, C-Myc tag HG16685-CM
ARHGAP1 cDNA ORF Clone, Human, N-Myc tag HG16685-NM
ARHGAP1 qPCR Primer Pairs, Human HP104835
info info
添加购物车成功! 添加购物车失败!