Quick Order

Human APOL2/Apolipoprotein L 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human APOL2 cDNA Clone Product Information
NCBI RefSeq:BC004395
RefSeq ORF Size:1014bp
cDNA Description:Full length Clone DNA of Homo sapiens apolipoprotein L, 2.
Gene Synonym:APOL3, APOL-II
Restriction Site:KpnI (two restriction sites) + XhoI (5.5kb + 0.64kb + 0.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human APOL2 Gene Plasmid Map
Human APOL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human APOL2/Apolipoprotein L 2 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG12501-G-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human APOL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.