Quick Order

Human ANPEP natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ANPEP cDNA Clone Product Information
NCBI RefSeq:NM_001150.2
RefSeq ORF Size:2904bp
cDNA Description:Full length Clone DNA of Homo sapiens alanyl (membrane) aminopeptidase.
Gene Synonym:ANPEP, APN, CD13, LAP1, PEPN, gp150
Restriction Site:KpnI (two restriction sites) + XhoI (5.5kb + 2.53kb + 0.37kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ANPEP Gene Plasmid Map
Human ANPEP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human ANPEP natural ORF mammalian expression plasmid on other vectors
Product nameProduct name

Aminopeptidase N (ANPEP or APN), also known as CD13, is a cell-surface metalloprotease located in the small-intestinal and renal microvillar membrane, as well as other plasma membranes. It belongs to the peptidase M1 family. CD13 plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases and is involved in the metabolism of regulatory peptides by diverse cell types. CD13/APN is a potent regulator of angiogenesis which is essential for tumor invasion and metastasis, and its transcription in activated endothelial cells is induced by angiogenic growth factors via the RAS/MAPK pathway. In addition, this enzyme has been shown to participate in antigen processing and presentation, and accordingly, defects in this gene appear to be a cause of various types of leukemia or lymphoma and carcinomas.

  • Pasqualini R, et al. (2000) Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis.Cancer Res. 60(3): 722-7.
  • Mabjeesh SJ, et al. (2005) Aminopeptidase N gene expression and abundance in caprine mammary gland is influenced by circulating plasma peptide. J Dairy Sci. 88(6): 2055-64.
  • Dunkel B, et al. (2009) Neutrophil and platelet activation in equine recurrent airway obstruction is associated with increased neutrophil CD13 expression, but not platelet CD41/61 and CD62P or neutrophil-platelet aggregate formation. Vet Immunol Immunopathol. 131(1-2): 25-32.
  • Size / Price
    Catalog: HG10051-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    • Human ANPEP Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.