JAML cDNA ORF Clone, Human, untagged

Cat: HG10120-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All JAML Reagents
CRO Services

All JAML Reagents
JAML cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 276 G/C not causing the amino acid variation.
Description
Full length Clone DNA of Human adhesion molecule, interacts with CXADR antigen 1, transcript variant 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
JAML cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

JAML cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
JAML cDNA ORF Clone, Human, untagged Alternative Names
AMICA cDNA ORF Clone, Human;CREA7-1 cDNA ORF Clone, Human;CREA7-4 cDNA ORF Clone, Human;Gm638 cDNA ORF Clone, Human;JAML cDNA ORF Clone, Human
JAML Background Information

Junctional adhesion molecules (JAMs) are endothelial and epithelial adhesion molecules involved in the recruitment of circulating leukocytes to inflammatory sites. JAML (Junctional adhesion molecule-like), also known as AMICA1 (Adhesion molecule interacting with CXADR antigen 1), a protein related to the JAM family, is restricted to leukocytes and promotes their adhesion to endothelial cells. It contains 2 extracellular immunoglobulin-like domains, a transmembrane segment, and a cytoplasmic tail involved in activation signaling. Monocytic JAML/AMICA1 plays a critical role in regulating monocyte transendothelial migration (TEM) probably via binding to the endothelial coxsackie and adenovirus receptor (CAR) and other tight junction-associated adhesive molecules. The Expression of JAML/AMICA1 is restricted to the hematopoietic tissues with the exception of liver. JAML may function in transmigration of leukocytes through epithelial and endothelial tissues. Expressed at the plasma membrane of polymorphonuclear leukocytes, JAML/AMICA1 also enhances myeloid leukemia cell adhesion to endothelial cells.

Full Name
adhesion molecule, interacts with CXADR antigen 1
References
  • Moog-Lutz C, et al. (2003) JAML, a novel protein with characteristics of a junctional adhesion molecule, is induced during differentiation of myeloid leukemia cells. Blood. 102(9): 3371-8.
  • Luissint AC, et al. (2008) JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by alpha4beta1 integrin activation. J Cell Biol. 183(6): 1159-73.
  • Guo YL, et al. (2009) Role of junctional adhesion molecule-like protein in mediating monocyte transendothelial migration. Arterioscler Thromb Vasc Biol. 29(1): 75-83.
  • JAML cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    JAML cDNA ORF Clone in Cloning Vector, Mouse MG51130-G
    JAML cDNA ORF Clone, Mouse, untagged MG51130-UT
    JAML cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51130-ACG
    JAML Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51130-ACGLN
    JAML cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51130-ACR
    JAML cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51130-CF
    JAML cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51130-NF
    JAML cDNA ORF Clone, Mouse, C-His tag MG51130-CH
    JAML cDNA ORF Clone, Mouse, N-His tag MG51130-NH
    JAML cDNA ORF Clone, Mouse, C-HA tag MG51130-CY
    JAML cDNA ORF Clone, Mouse, N-HA tag MG51130-NY
    JAML cDNA ORF Clone, Mouse, C-Myc tag MG51130-CM
    JAML cDNA ORF Clone, Mouse, N-Myc tag MG51130-NM

    JAML cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    JAML cDNA ORF Clone in Cloning Vector, Human HG10120-M
    JAML cDNA ORF Clone, Human, untagged HG10120-UT
    JAML Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10120-ACGLN
    JAML cDNA ORF Clone, Human, C-GFPSpark® tag HG10120-ACG
    JAML cDNA ORF Clone, Human, C-OFPSpark® tag HG10120-ACR
    JAML cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10120-CF
    JAML cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10120-NF
    JAML cDNA ORF Clone, Human, C-His tag HG10120-CH
    JAML cDNA ORF Clone, Human, N-His tag HG10120-NH
    JAML cDNA ORF Clone, Human, C-HA tag HG10120-CY
    JAML cDNA ORF Clone, Human, N-HA tag HG10120-NY
    JAML cDNA ORF Clone, Human, C-Myc tag HG10120-CM
    JAML cDNA ORF Clone, Human, N-Myc tag HG10120-NM
    JAML qPCR Primer Pairs, Human HP100194
    info info
    添加购物车成功! 添加购物车失败!