After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human JAML/AMICA1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human JAML cDNA Clone Product Information
NCBI RefSeq:NM_001098526.1
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Homo sapiens adhesion molecule, interacts with CXADR antigen 1, transcript variant 1 with Flag tag.
Gene Synonym:JAML, AMICA, Gm638, CREA7-1, CREA7-4, FLJ37080, MGC118814, MGC118815, AMICA1
Restriction Site:KpnI + XhoI (5.5kb + 1.22kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 276 G/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human JAML Gene Plasmid Map
Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Junctional adhesion molecules (JAMs) are endothelial and epithelial adhesion molecules involved in the recruitment of circulating leukocytes to inflammatory sites. JAML (Junctional adhesion molecule-like), also known as AMICA1 (Adhesion molecule interacting with CXADR antigen 1), a protein related to the JAM family, is restricted to leukocytes and promotes their adhesion to endothelial cells. It contains 2 extracellular immunoglobulin-like domains, a transmembrane segment, and a cytoplasmic tail involved in activation signaling. Monocytic JAML/AMICA1 plays a critical role in regulating monocyte transendothelial migration (TEM) probably via binding to the endothelial coxsackie and adenovirus receptor (CAR) and other tight junction-associated adhesive molecules. The Expression of JAML/AMICA1 is restricted to the hematopoietic tissues with the exception of liver. JAML may function in transmigration of leukocytes through epithelial and endothelial tissues. Expressed at the plasma membrane of polymorphonuclear leukocytes, JAML/AMICA1 also enhances myeloid leukemia cell adhesion to endothelial cells.

  • Moog-Lutz C, et al. (2003) JAML, a novel protein with characteristics of a junctional adhesion molecule, is induced during differentiation of myeloid leukemia cells. Blood. 102(9): 3371-8.
  • Luissint AC, et al. (2008) JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by alpha4beta1 integrin activation. J Cell Biol. 183(6): 1159-73.
  • Guo YL, et al. (2009) Role of junctional adhesion molecule-like protein in mediating monocyte transendothelial migration. Arterioscler Thromb Vasc Biol. 29(1): 75-83.
  • Size / Price
    Catalog: HG10120-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human AMICA1 / JAML transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.