After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ALDH3A1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ALDH3A1 cDNA Clone Product Information
NCBI RefSeq:BC004370
RefSeq ORF Size:1362bp
cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 3 family, member A1.
Gene Synonym:ALDH3, ALDHIII
Restriction Site:KpnI + XhoI (5.5kb + 1.36kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ALDH3A1 Gene Plasmid Map
Human ALDH3A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human ALDH3A1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
  • Pappa A, et al. (2003) Human aldehyde dehydrogenase 3A1 (ALDH3A1): biochemical characterization and immunohistochemical localization in the cornea. Biochem J. 376(3): 615-23.
  • Estey T, et al. (2007) ALDH3A1: a corneal crystallin with diverse functions. Experimental Eye Research. 84(1):3-12.
  • Pappa A, et al. (2003) Aldh3a1 protects human corneal epithelial cells from ultraviolet- and 4-hydroxy-2-nonenal-induced oxidative damage. Free Radical Biology and Medicine. 34(9):1178-89.
  • Size / Price
    Catalog: HG12523-G-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.