alpha 2b Adrenergic Receptor/ADRA2B cDNA ORF Clone, Human, C-His tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

alpha 2b Adrenergic Receptor/ADRA2B cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1353 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 1078A/C not causing the amino acid variation.
Description
Full length Clone DNA of Human adrenergic, alpha-2B-, receptor with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
HindIII + XhoI (5.5kb + 1.38kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

alpha 2b Adrenergic Receptor/ADRA2B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha 2b Adrenergic Receptor/ADRA2B cDNA ORF Clone, Human, C-His tag: Validated Images

alpha 2b Adrenergic Receptor/ADRA2B cDNA ORF Clone, Human, C-His tag: Alternative Names

ADRA2L1 cDNA ORF Clone, Human; ADRA2RL1 cDNA ORF Clone, Human; ADRARL1 cDNA ORF Clone, Human; alpha-2BAR cDNA ORF Clone, Human; ALPHA2BAR cDNA ORF Clone, Human; FAME2 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed