ADCK5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10071-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADCK5 Reagents
CRO Services

All ADCK5 Reagents
ADCK5 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1743 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human aarF domain containing kinase 5 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 1.77kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ADCK5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADCK5 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
ADCK5 Background Information
Full Name
aarF domain containing kinase 5

ADCK5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ADCK5 cDNA ORF Clone in Cloning Vector, Rat RG81131-U
ADCK5 cDNA ORF Clone, Rat, untagged RG81131-UT
ADCK5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81131-ACGLN
ADCK5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81131-ACG
ADCK5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81131-ACR
ADCK5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81131-CF
ADCK5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81131-NF
ADCK5 cDNA ORF Clone, Rat, C-His tag RG81131-CH
ADCK5 cDNA ORF Clone, Rat, N-His tag RG81131-NH
ADCK5 cDNA ORF Clone, Rat, C-HA tag RG81131-CY
ADCK5 cDNA ORF Clone, Rat, N-HA tag RG81131-NY
ADCK5 cDNA ORF Clone, Rat, C-Myc tag RG81131-CM
ADCK5 cDNA ORF Clone, Rat, N-Myc tag RG81131-NM
ADCK5 qPCR Primer Pairs, Rat RP301088

ADCK5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ADCK5 cDNA ORF Clone in Cloning Vector, Mouse MG51613-U
ADCK5 cDNA ORF Clone, Mouse, untagged MG51613-UT
ADCK5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51613-ACG
ADCK5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51613-ACGLN
ADCK5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51613-ACR
ADCK5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51613-CF
ADCK5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51613-NF
ADCK5 cDNA ORF Clone, Mouse, C-His tag MG51613-CH
ADCK5 cDNA ORF Clone, Mouse, N-His tag MG51613-NH
ADCK5 cDNA ORF Clone, Mouse, C-HA tag MG51613-CY
ADCK5 cDNA ORF Clone, Mouse, N-HA tag MG51613-NY
ADCK5 cDNA ORF Clone, Mouse, C-Myc tag MG51613-CM
ADCK5 cDNA ORF Clone, Mouse, N-Myc tag MG51613-NM
ADCK5 qPCR Primer Pairs, Mouse MP201280

ADCK5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ADCK5 cDNA ORF Clone in Cloning Vector, Human HG10071-M
ADCK5 cDNA ORF Clone, Human, untagged HG10071-UT
ADCK5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10071-ACG
ADCK5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10071-ACGLN
ADCK5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10071-ACR
ADCK5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10071-CF
ADCK5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10071-NF
ADCK5 cDNA ORF Clone, Human, C-His tag HG10071-CH
ADCK5 cDNA ORF Clone, Human, N-His tag HG10071-NH
ADCK5 cDNA ORF Clone, Human, C-HA tag HG10071-CY
ADCK5 cDNA ORF Clone, Human, N-HA tag HG10071-NY
ADCK5 cDNA ORF Clone, Human, C-Myc tag HG10071-CM
ADCK5 cDNA ORF Clone, Human, N-Myc tag HG10071-NM
ADCK5 qPCR Primer Pairs, Human HP100157
info info
添加购物车成功! 添加购物车失败!