Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human ADAM17 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human ADAM17 Gene Plasmid Map
Human ADAM17 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

ADAM17 is a member of the ADAM protein family of disintegrins and metalloproteases. ADAM17 is ubiquitously expressed in the human colon, with increased activity in the colonic mucosa of patients with ulcerative colitis, a main form of inflammatory bowel disease. The expression of ADAM17 may be inhibited by ethanol. It is involved in the processing of tumor necrosis factor alpha (TNF-α) at the surface of the cell, and from within the intracellular membranes of the trans-Golgi network. ADAM17 also plays a role in the release of a diverse variety of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes. ADAM17 may play a prominent role in the Notch signaling pathway, during the proteolytic release of the Notch intracellular domain (from the Notch1 receptor) that occurs following ligand binding.

References
  • Poghosyan. et al., 2002, J Biol Chem. 277 (7): 4999-5007.
  • Li Y. et al., 2006, Blood. 108 (7): 2275-9.
  • Peiretti. et al., 2003, J Cell Sci. 116 (10): 1949-57.
  • Contact Us
    Images
    • Human ADAM17 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"