After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ACVR2B/Activin RIIB Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ACVR2B cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations 333 A/G and 1458 C/T not causing the amino acid variation.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

ACVR2A and ACVR2B are two activin type II receptors. ACVR2B is integral to the activin and myostatin signaling pathway. Ligands such as activin and myostatin bind to ACVR2A and ACVR2B. Myostatin, a negative regulator of skeletal muscle growth, is regarded as a potential therapeutic target and binds to ACVR2B effectively, and to a lesser extent, to ACVR2A. The structure of human ACVR2B kinase domain in complex with adenine establishes the conserved bilobal architecture consistent with all other catalytic kinase domains. Haplotype structure at the ACVR2B and follistatin loci may contribute to interindividual variation in skeletal muscle mass and strength. Defects in ACVR2B are a cause of left-right axis malformations.

  1. Kosaki R, et al. (1999) Left-right axis malformations associated with mutations in ACVR2B, the gene for human activin receptor type IIB. Am J Med Genet. 82(1):70-6.
  2. Dupont S, et al. (2001) No evidence for linkage or for diabetes-associated mutations in the activin type 2B receptor gene (ACVR2B) in French patients with mature-onset diabetes of the young or type 2 diabetes. Diabetes 50(5):1219-21.
  3. Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  4. Walsh S, et al. (2007) Activin-type II receptor B (ACVR2B) and follistatin haplotype associations with muscle mass and strength in humans. J Appl Physiol. 102(6):2142-8.
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.