After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human ACE2 / Angiotensin-Converting Enzyme 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ACE2 cDNA Clone Product Information
NCBI RefSeq:NM_021804.1
RefSeq ORF Size:2418bp
cDNA Description:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2.
Gene Synonym:ACE2, ACEH, DKFZP434A014
Restriction Site:KpnI + XhoI (5.5kb + 2.42kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ACE2 Gene Plasmid Map
Human ACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.