Quick Order

Human ABCF1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human ABCF1 cDNA Clone Product Information
    NCBI RefSeq:NM_001025091.1
    RefSeq ORF Size:2538bp
    cDNA Description:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family F (GCN20), member 1ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1.
    Gene Synonym:ABC27, ABC50,
    Species:Human
    Vector:pCMV/hygro
    Plasmid:pCMV-ABCF1
    Restriction Site:KpnI + XhoI (5.5kb + 2.54kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ABCF1 qPCR primers for gene expression analysis, HP100831 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"